Transcript asmbl_53319

Sequence
Transcript Sequence for observation asmbl_53319 of TGE0025077:
AAGTCCAGGGTTAAGTACAGAAGGTAAGAGATGGATTTCAAATCTAAAGCGGGAAGCCAGTATCTGTCATATGCTGAAACATCCCCACATTGTAGAATTATTGGAGACATATAGCTCAGATGGAATGCTTTACATGGTTTTTGAATTTATGGATGGAGCGGATCTATGTTTTGAAATCGTAAAACGAGCTGACGCTGGTTTTGTATACAGTGAAGCTGTAGCCAGTCATTACATGAGACAGATACTGGAAGCTCTGCGCTATTGTCATGATAACAACATAATTCACAGAGATGTGAAGCCTCACTGTGTTCTACTGGCCTCAAAGGAAAACTCAGCACCTGTCAAGCTTGGAGGCTTTGGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAGGACGTGTTGGAACACCTCATTTTATGGCTCCAGAAGTTGTCAAAAGAGAGCCTTATGGAAAACCTGTAGATGTCTGGGGTTGTGGCGTGATCCTTTTTATCCTGCTAAGTGGTTGTTTGCCTTTTTATGGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGGAAATATAAGATGAATCCAAGGCAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTGCGTCGCATGCTGATGCTGGATCCAGCTGAAAGGATCACTGTTTATGAAGCGCTGAATCACCCTTGGCTTAAGGAGCGGGATCGTTATGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAACTGAGGAAATTCAATGCAAGGAGGAAATTAAAGGGTGCAGTTCTAGCAGCTGTGTCAAGTCACAAATTCAACTCATTCTATGGGGATCCCCCTGAAGAGTTGCCAGACTTTTCTGAAGACCCTACCTCCTCAGGAGCAGTCTCACAGGTGCTAGACAGCTTGGAAGAAATTCACGCACTTACAGACTGCAGTGAAAAGGACTTAGATTTTCTGCACAGTGTTTTCCAGGATCAGCATCTTCACACACTACTAGATCTGTATGACAAAATTAATACAAAGTCTTCACCACAAATCAGGAATCCTCCAAGTGATGCTGTACAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCTGAGAATAATGACGCAAAGGAACTAAAGCGTATTTTAACACAACCTCATTTCATGGCCTTACTTCAGACTCACGATGTAGTGGCACATGAAGTTTACAGTGACGAAGCACTGAGGGTCACACCTCCTCCCACCTCTCCCTATTTAAATGGTGATTCTCCAGAAAGCGCCAACGGAGACATGGATATGGAGAACGTGACCAGAGTTCGGCTGGTCCAGTTCCAAAAGAACACAGATGAACCAATGGGAATCACTTTAAAAATGAATGAGCTAAATCATTGTATTGTTGCAAGAATTATGCATGGAGGCATGATTCACAGGCAAGGTACACTTCATGTCGGTGATGAAATTCGAGAAATCAATGGCATCAGTGTGGCTAACCAAACAGTGGAGCAGCTGCAAAAAATGCTTCGAGAAATGCGGGGGAGTATCACCTTCAAGATCGTGCCAAGTTACCGCACTCAATCATCATCCTGTGAGGACTTGCCATCAACTACCCAACCAAAAGGACGACAGATCTATGTAAGAGCACAATTTGAATATGATCCAGCCAAGGATGACCTCATCCCCTGCAAGGAAGCTGGCATTCGATTCAGAGTTGGTGACATTATCCAGATTATTAGTAAGGATGATCACAATTGGTGGCAGGGTAAACTGGAAAACTCCAAAAATGGAACTGCAGGTCTCATTCCTTCTCCTGAACTTCAGGAATGGCGAGTAGCTTGCATCGCCATGGAGAAGACCAAACAGGAGCAGCAGGCCAGCTGTACTTGGTTTGGCAAGAAAAAGAAGCAGTACAAAGATAAATATTTGGCAAAGCACAATGCAGTGTTTGATCAATTAGATCTTGTTACATATGAAGAAGTAGTAAAACTGCCAGCATTCAAAAGGAAAACACTAGTCTTATTAGGTGCACATGGTGTTGGGAGAAGACACATAAAAAATACCCTCATCACAAAGCACCCAGACCGATTTGCATACCCTATTCCACATACAACCAGACCTCCAAAGAAAGATGAAGAAAATGGAAAGAATTATTACTTTGTATCTCATGACCAAATGATGCAAGACATCTCTAATAATGAATACTTGGAGTATGGCAGCCATGAGGATGCGATGTATGGGACAAAACTGGAGACCATACGGAAGATCCACGAGCAGGGGCTGATTGCAATACTGGACGTGGAGCCTCAGGCACTGAAGGTCCTGAGAACTGCCGAGTTTGCTCCTTTTGTTGTTTTTATTGCTGCACCAACTATTACTCCAGGTTTGAATGAGGATGAATCTCTTCAGCGTCTGCAGAAGGAGTCTGATATCTTACAGAGAACATATGCACACTACTTTGATCTCACAATTATCAACAATGAAATTGATGAGACAATCAGACATCTAGAGGAAGCCGTCGAGCTCGTGTGCACAGCCCCGCAGTGGGTCCCAGTCTCCTGGGTCTATTAGGCCTCTCCCCAGATATCTGACGTATAACTGGGAGCCACCTCATACATGGAAACGCCTCTTTGTTATCGACCTTGTGTCAGCAGGTCGTGGTCCCTAGAGACTACCTAGTTGTAGTGTGACCTACATTTATAATTATTGTCATGTCCGAATAGGTAGGAGGAGAAAAACAATTACACACTAATTTAAAGAGACAGTATCTTTTTTAATCAGTTCTCCTAAACTTTAATAAAATGTATCTTTAAATGTATGTATTATTCAATCCTTTGGAATGTTATATTTTTGGAAATCATAGCTTTTTATTTCCAAGGCCCCTAAAAACTGCACAAAATAGATGCTGCTTTCT