Transcript asmbl_10092

Sequence
Transcript Sequence for observation asmbl_10092 of TGE0003517:
CTGAGCTCAGAGAAGTGATCGCTTTGGCGGTCGCGATGGGCAAGTCAGATTTTCTCACCCCCAAGGCTATCGCCAACAGGATCAAATCCAAAGGGCTTCAGAAGCTGCGCTGGTATTGCCAGATGTGCCAGAAGCAGTGCCGCGACGAGAATGGCTTTAAGTGTCATTGTATGTCCGAATCTCATCAGAGACAACTATTGCTGGCCTCGGAAAATCCTCAGCAGTTTATGGATTATTTTTCAGAAGAATTCCGAAATGACTTTCTAGAACTTCTCAGGAGACGCTTTGGCACTAAGAGAGTCCACAACAACATTGTTTACAATGAGTATATCAGCCACCGGGAGCACATCCACATGAATGCCACCCAGTGGGAGACCCTGACCGATTTTACTAAGTGGCTGGGCAGAGAAGGCTTGTGCAAAGTGGACGAGACACCGAAAGGCTGGTACATTCAGTATATAGACAGGGACCCAGAGACTATCCGGCGCCAGCTAGAACTAGAGAAAAAGAAGAAGCAGGACCTTGATGATGAAGAAAAAACCGCCAAATTTATTGAAGAACAAGTGAGAAGAGGTCTGGAAGGGAAAGAACAGGAGGCCCCTGTTTTTACGGAATTAAGCAGAGAAAATGATGAAGAAAAAGTTACATTTAATTTGAATAAAGGAGCATGCAGTTCAGCGGCAACGTCTTCCAAGTCAAGTTCTCTGGGACCAAGCGCGTTGACGATGAGCGGGACCGCAGCGTCCGTGAAGCGGAAAGAGGCCTCCCAGGGCTCGGCTCAGCCCAAAGACAAGAAGAAGAAGAAAAGTGCACTCGACGAGATCATGGAGATTGAAGAGGGAAAGAAACGGGCTTCTCGAACAGACTACTGGCTGCAGCCGGTGCGTGTGCTTCCGCTGTCAGTGCTGCCGGTAGCTTCGGTGTAAACGACTGGCCTCCTTGACCACGTGTGCATTACACACCCAACCCTCTAACTGTGATGCGTTTTTTTCTATTTGATTTTTAATTATTAGCTGCGTCTGTA