Transcript asmbl_10091

Sequence
Transcript Sequence for observation asmbl_10091 of TGE0003516:
CTGAGCTCAGAGAAGTGATCGCTTTGGCGGTCGCGATGGGCAAGTCAGATTTTCTCACCCCCAAGGCTATCGCCAACAGGATCAAATCCAAAGGGCTTCAGAAGCTGCGCTGGTATTGCCAGATGTGCCAGAAGCAGTGCCGCGACGAGAATGGCTTTAAGTGTCATTGTATGTCCGAATCTCATCAGAGACAACTATTGCTGGCCTCGGAAAATCCTCAGCAGTTTATGGATTATTTTTCAGAAGAATTCCGAAATGACTTTCTAGAACTTCTCAGGAGACGCTTTGGCACTAAGAGAGTCCACAACAACATTGTTTACAATGAGTATATCAGCCACCGGGAGCACATCCACATGAATGCCACCCAGTGGGAGACCCTGACCGATTTTACTAAGTGGCTGGGCAGAGAAGGCTTGTGCAAAGTGGACGAGACACCGAAAGGCTGGTACATTCAGTATATAGACAGGGACCCAGAGACTATCCGGCGCCAGCTAGAACTAGAGAAAAAGAAGAAGCAGGACCTTGATGATGAAGAAAAAACCGCCAAATTTATTGAAGAACAAGTGAGAAGAGGTCTGGAAGGGAAAGAACAGGAGGCCCCTGTTTTTACGGAATTAAGCAGAGAAAATGATGAAGAAAAAGTTACATTTAATTTGAATAAAGGAGCATGCAGTTCAGCGGCAACGTCTTCCAAGTCAAGTTCTCTGGGACCAAGCGCGTTGACGATGAGCGGGACCGCAGCGTCCGTGAAGCGGAAAGAGGCCTCCCAGGGCTCGGCTCAGCCCAAAGACAAGAAGAAGAAGAAAAGTGCACTCGACGAGATCATGGAGATTGAAGAGGGAAAGAAACGGGCTTCTCGAACAGACTACTGGCTGCAGCCGGAAATCGTCGTGAAAATTATAACCAAAAAACTCGGAGAGAAATATCATAAGAAAAAGGGCATTGTTAAGGAAGTAATTGACAAGTATACAGCTGTCGTAAAGATGATTGACTCTGGAGACAAGCTGAAACTTGACCAGACCCATTTAGAAACAGTCATTCCAGCACCAGGAAAGAGAATCCTCGTTTTAAATGGCGGCTACAGAGGAAATGAGGGGACCTTAGAATCCATCAACGAGAAGACCTTTTCCGCTACTATAGTCATTGAAACTGGCCCTTTAAAAGGTCGCAGAGTGGAAGGAATTCAATATGAAGACATTTCTAAACTTGCTTGAGTTTGAAAATTTGTTAACAACGTATTAAAATCCTAAAGCATCAAATTGGTGTTCGCCAAGGCATTATGAGACTCTACTGTGTTAGGGTGATTCTTTTGTATAAACGAACGGATTTATTTAAATATTACTGTATAGCCGTTTAGCTAAACTTACAGAAAAATCTAATTATGTCTCATGAAGTATCAAAACGATGTAAATTTATCCTTGTTACTTTTGTTTTGTAATATTTCCTTGAGTTTT