Transcript asmbl_10090

Sequence
Transcript Sequence for observation asmbl_10090 of TGE0003515:
ACCAAACCTTCCAACTTTTTCCCCCCTAAGGAGGCCCCTGTTTTTACGGAATTAAGCAGAGAAAATGATGAAGAAAAAGTTACATTTAATTTGAATAAAGGAGCATGCAGTTCAGCGGCAACGTCTTCCAAGTCAAGTTCTCTGGGACCAAGCGCGTTGACGATGAGCGGGACCGCAGCGTCCGTGAAGCGGAAAGAGGCCTCCCAGGGCTCGGCTCAGCCCAAAGACAAGAAGAAGAAGAAAAGTGCACTCGACGAGATCATGGAGATTGAAGAGGGAAAGAAACGGGCTTCTCGAACAGACTACTGGCTGCAGCCGGAAATCGTCGTGAAAATTATAACCAAAAAACTCGGAGAGAAATATCATAAGAAAAAGGGCATTGTTAAGGAAGTAATTGACAAGTATACAGCTGTCGTAAAGATGATTGACTCTGGAGACAAGCTGAAACTTGACCAGACCCATTTAGAAACAGTCATTCCAGCACCAGGAAAGAGAATCCTCGTTTTAAATGGCGGCTACAGAGGAAATGAGGGGACCTTAGAATCCATCAACGAGAAGACCTTTTCCGCTACTATAGTCATTGAAACTGGCCCTTTAAAAGGTCGCAGAGTGGAAGGAATTCAATATGAAGACATTTCTAAACTTGCTTGAGTTTGAAAATTTGTTAACAACGTATTAAAATCCTAAAGCATCAAATTGGTGTTCGCCAAGGCATTATGAGACTCTACTGTGTTAGGGTGATTCTTTTGTATAAACGAACGGATTTATTTAAATATTACTGTATAGCCGTTTAGCTAAACTTACAGAAAAATCTAATTATGTCTCATGAAGTATCAAAACGATGTAAATTTATCCTTGTTACTTTTGTTTTGTAATATTTCCTTGAGTTTTTAATCTTT