Transcript asmbl_53101

Sequence
Transcript Sequence for observation asmbl_53101 of TGE0009868:
CCGCGAGGTGTCACGTCTGGCCGCGGTTTGACGGAGGTGGTTGTGGGCTCGTAGGGTCTTCGCTGCCTCCGTCCTCCCTTCCATTTCCGCGTCCTCATCTCCCGGGTCCCGGGGGGCCCCCGCCCGGGGAAGCGCTGTTGCTGAGTTCGGTGTCTGAGCAGAGACGTGGTTGGTGACAGCATGACGAGCGAGGTGATAGAAGATGAGAAACAATTCTACTCGAAGGCGAAGACGTACTGGAAAGAAGTCCCACCGACGGTGGACGGCATGCTCGGGGGGTACGGCCACATCTCCAGCATCGACATCAACAGCTCCCGGAAGTTCCTGCAGAGGTTTTTGAGGGTAGGCAGGTCTGGTGTGCCCTCCAGGAGTAGAGGAAGTGGCGCTGGCGCCACCTTTACGTGTGCCACTGCAGGGTCTTCGGTTACCTGTCGGTGTCTACCATCCAAGCCTTGAAGGGCAGGGGACGGCTTGTGGACTGTGGACTTTGCTCAAGGTTGCAGACAGGAGCTGGGGGACCCCCAGATGCCAGAATCGAGTAGTCTCCCCGTAAGCTGTCCAGTTTTGCCAGGGACGAAACCTCTGCCCTCCTGCCCTGTTCCTGGGCACTTGGGCTGCGGGGCTTGGCTGTTCTGGCGAAGGCAGGCCCCCGGTTACTCGCCCCCACTGCCCTCCCGGCCCGGGCTGGCCTCTCCGTGGCTGGAGCCTCCCTGACCACCCCCGCAAGCTCCGAGGCTGCTGCTCTGACTGGTGTCTGTCACTCCCTGTCTTCCCAAATGGGTTAGAATCCCGTAGACGCTAGCTGATTGTCTTCTTCCATGTTCACGCATGAATTCTTTTTATCCTCCACGCTCATTCTCATGGCGTCTCAGGCGTGAGAGATGAATGCACCTGTTTGAATTAGCACCTTTAATCGGAAGTTGGCTTTCATTTTAGAAACGCGTGGCCCAGAAAAAGAATGTGCTGTGCTCACACAGTGATGCCCCTACTGAGCCAGCCCCCAGCCTGTGCCTGGTCCAGATCTGAGTAAACCCAGGGGCTCGTGAGGGGTGGCCCCGGTGCAGTGACAGGGTCCCTCGGGCTTTCGGTCCCTTCCTGACAGCACCTCCGCCTTCCCTGCATCTTAGGAAGGCCCAAACAAGACGGGCACCTCCTGCGCCCTGGACTGCGGCGCCGGCATCGGAAGGATCACCAAGCGGCTGCTCCTGCCGCTCTTCGGGGCGGTGGACATGGTGGACGTGACGGAGGACTTCCTGGTGAAAGCGAAGACCTACCTGGGTGAGGAGGGCAAGAGGGTGAGGAACTACTTCTGCTGTGGCCTCCAGGACTTCAGCCCAGAGCCTAACTCGTACGACGTCATCTGGATCCAGTGGGTGATCGGCCACCTGACCGACCAGCACCTGGCCGAGTTCCTGCGGCGCTGCAAGCGGGGCCTTCGCCCCAACGGCGTCATCGTCATCAAGGACAACATGGCTCAAGAGGGTGTGATCCTGGACGACGTGGACAGCAGCGTGTGCCGGGACCTCGGGGTGGTCCACAGCATCATCCGCAGCGCGGGCCTCAGCCTCCTGGCCCAGGAGCGGCAGGAGAACCTCCCCGACGAGATCTACCATGTCTACAGCTTAGCCCTGAGATGAGCGGGGCCTGGCAGGACGAGAGAGACAGGTGCAGGGGTGGGGGGAGCTGGCAGCTGGGTGCCACACAGAGGCTCCACGTCGATGGGTCGCGAGTGTCGAGCGAGGCCACTAAATACATCTGCCTGCCGTCCACTCACTACACAGGCTCTTCTTAAAAATGACAGGACCCAGAGGGGAGGGGTGCAGCTGAATGGGCAGCAAGGCAGGAGCCTGGCTCTGCCACCCTAAGGCAAGGGACTGGGCAGTGCAGGCCTGTGCGACTTGGGGGCCCCTCTGCGGGAATACAGTGATCCATCAGAAGCGGAGGTTCCTGGGTCTCTTACGACCACTGGGCCTTGTGGCCCCAGGCCTGGCTGCCTTAAGAGGAAGAGAAACCCCTTAACTTGGTTGTTGAGGACGCTACCTCGGGGGAGACGGACAGGCTGCTGGAGCCTGCAGCAAGCCCACGTGGCACCTGCCGGATCATGCAGCTGGCAGGGAGCTCATGTTCTGAGTCCTCTTTGATGATGGGACCCTGGTGTCCTTAATGTGATCATCACAATAGCCTGAAGCAAGGAGAGAAGGCTGCAGCCTCGCTCTGGGCGGGCATTTCCAGTCAAAAATAAAAGGGTGGATCCCTGTGCTGGGAAGGTCCGGCCTGTGTGCGGTGGTGCTTTTCTTTATGCA