Transcript asmbl_10063

Sequence
Transcript Sequence for observation asmbl_10063 of TGE0003514:
CTCTCCTAGAAAAGTCATCTTCTCACGAACCTTTAAAATTTCTGCCTCCCGAGGCAACCTTAAAGGACTAGGGCTGACTGCCTCATCTTTTTCTCCCTTGCAAAAGTCCCGTTTGCCACCATGGGGATGTACCAAGTGAGACCAAGTAGGGGGAGCGAATGGTGACTGGTACGCTGGGCTTACTGGCTGCTGCCCACTTCAGCGCTAGCACACTTCTGTAAGATCGGAACTGAGTACTAAACAACCTCTACACTTCCCCCTGGCGCCATTCCAGGGCTGGCGCCACATTCCCTGGTGGGCACGCAATGGCCGCGCCCCCTCCAGCGGCGGACGGGTCTTTTGGTACGTGCAGTCCGAGGTTGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGTGTAGACAAGACCAATGGTGCCCCTGAACAGATAGGCCTGGATGAGAGTGGCGGTGGCGGCGGCAGTGACCTTGGAGAGGCCCCTACTCGTGCAGCCCCTGGAGAACCTCGCTCTGGACGGGGACCACTCAGCTCTGCACCAGAGATTGTACACGAGGACTTGAAGATGGGGTCTGACGGGGAAAGTGACCAGGCTTCAGCCACATCCTCAGATGAGGTGCAGTCGCCAGTGAGGGTGCGCATGCGCAACCATCCCCCACGCAAGATCTCCACTGAGGACATCAACAAGCGCCTATCACTACCAGCTGACATCCGGTTGCCCGAGGGCTACCTTGAGAAGCTGACCCTCAATAGCCCCATCTTCGATAAGCCCCTCAGCCGCCGCCTCCGTCGTGTCAGCTTGTCCGAGATTGGCTTTGGGAAACTGGAGACATATATCAAGCTGGACAAGCTGGGCGAGGGTACCTATGCCACCGTCTACAAAGGCAAAAGCAAGCTCACAGACAACCTTGTGGCACTCAAGGAGATCAGACTGGAACACGAAGAGGGGGCACCCTGTACGGCCATCCGGGAAGTGTCCCTGCTCAAGGACCTCAAACATGCCAACATCGTCACACTACATGACATTATCCACACTGAGAAGTCCCTCACTCTTGTCTTTGAGTACCTGGACAAAGACCTGAAGCAGTACCTGGATGACTGTGGGAACATCATCAACATGCATAATGTGAAACTGTTCCTGTTCCAGCTGCTCCGTGGTCTGGCCTACTGCCATCGGCAGAAGGTGCTACACCGTGACCTCAAGCCCCAGAACTTGCTCATCAATGAGAGAGGAGAGCTTAAGCTGGCTGATTTTGGCCTGGCTCGGGCCAAGTCAATTCCAACAAAGACCTACTCCAATGAGGTGGTGACACTATGGTACCGGCCCCCTGACATCCTGCTTGGGTCTACAGACTACTCCACCCAGATTGACATGTGGGGTGTGGGCTGCATCTTCTATGAGATGGCCACGGGCCGGCCCCTCTTCCCAGGCTCCACAGTGGAGGAACAGCTACACTTCATCTTCCGCATCTTGGGAACCCCAACTGAGGAGACATGGCCGGGCATCCTGTCCAACGAAGAATTCAAGACATACAACTACCCCAAGTACCGCTCTGAGACCCTTTTGAGCCATGCACCCCGACTTGACAGCGATGGGGCTGACCTCCTTACCAAGCTGCTGCAGTTTGAAGGTCGCAATCGGATCTCCGCAGAGGACTCCATGAAACACCCATTCTTCCTCGGTCTGGGGGAGCGGATCCACAAACTTCCTGACACTACTTCCATATTTGCACTAAAGGAGATCCAGCTACAAAAGGAGGCCAGCCTTCGCTCTTCGTCAATGCCTGACTCAGGCAGGCCAGCTTTCCGTGTGGTGGACACCGAGTTCTAAGCCACAGACCCAGGCCCCAGCAGGCAGCAGCTGGAGGGATGCCACACCCCTCACAGGGCAGACCCCAACTGCATCCTCCCTGCTTGCTACCTGCCTGACTCATGCTCGCCTGCCCACATGTCCCCTGCTGCCTGTCCAAAAACACATGATCATTGGCCTGTCAACCCACCCATTGGCCTGTCTGCTGGGTGCTAACAAAGCTCTCAATGCTCCTTGCCTGGTCTGTTTGTCTCTCTCTGTCTCAGTAGTTGCCGGCGGACAGCATGGCCGTGCCAGCCTCCCACACTGAGGCCAGGCCTATACCCCTCCCCATCATACCCTCCCCCAGGACCACTACCCCATGGCCAGCCAGGGGTCTGGAGCTAGCCCAGGCTGGGGATCTCGACTCAGACAAGATGGGGATGCCTTGAGTCTGAGGTTTCCCCTGCTTGCTTTCCTGCCTGTCCCACCTGCCTCATGTTGTGTGGGCTTTTTTGTTGTTGTTCATTTCATTCATTGTTTTTTAATTATTTTAAATGAGGTTTTCATTTTTTAAATGCAATATCTCTATACAGACTGGCTGGGCCCCACCCCCTGCGTGTGGCCCTCCCACAGTATTTTGTGCAATGAAGCCCCGCTCCCAGCCTTTCCAAGGCAGGGACACAGCCCCTATTCAGAACCCTGACCATCACCAGACCCTGGGATCGGCTAAGGGAAAGCATGCCTCAACCACTCGCCTTCCTACCCCCCACCTGCCATCCCCAGCCGCAGGGGTACCTGGGGACTACTGGAGACTCTGGGAGATGGACAAGGTTGGGGCCCCAGTCTTTCCCTCTTACAGTCCCATAGCTGGGGCCTCCTTCCTTCTCAGGGTCTCCCTAGCCCAGCCCTCTTGCCCCCACCCCACTCGGTGCTGTTGAGTAGGGGCCCTGCCAGGAACTGACCAACTCAGTGAGGAGCCATAGTATGTCTATGTGCACAGGCAGGGACAGAGGGGCTGGCGGGGGGATGGGGTGTGTGTGCCCAGGAGTTATCCCCTAACCCCTGGGGAGGGTGAGGCAGGGCAGGGACAGTCTCTGGGCTCAGTCCCAGATGGGTGATTACCTCCCCTTCCTCCACTCTAAACCCTGGGTCCCTTAAATGGGGTGGGAGGGCAGGGGTGGGTG