Transcript asmbl_52996

Sequence
Transcript Sequence for observation asmbl_52996 of TGE0025044:
GCGGAGGAGGTGGAGGAGGTGCCGGGCGGCCGCTTCCCGCCCCCGAGCGCGAGCCGGTTCCGAGCGGAGTGGAGCGGAGGTCGGACCCGGAGCGGAGCCGGCTGAGCGGGCGCTGAGCCCCCGCCATGGCCCGGAACACGCTGTCCTCGCGCTTCCGTCGGGTGGACATCGACGAGTTTGACGAGAACAAATTTGTGGACGAGCAGGAGGAGGCGGCGGCGGCGGCGGGCGAGCCAGGCCCGGACCCCAGCGAGGTGGATGGGCTCCTGCGGCAAGGGGACATGCTTCGGGCGTTTCACGCAGCCTTGAGGAACTCTCCTGTCAACACCAAGAATCAAGCCGTGAAGGAACGAGCCCAGGGCGTGGTGCTGAAAGTGCTTACAAATTTTAAGAGCAGCGAAATTGAGCAGGCTGTGCAGTCACTGGACAGAAATGGCATTGACTTGCTAATGAAGTACATTTATAAAGGGTTTGAGAAGCCCACAGAAAATAGCAGCGCAGTGTTACTCCAGTGGCATGAAAAGGTATGTGAACACGTTGCCCATGTCAGCAGCCAGCTGACTCACCCCAACCCCAAGGTTCAAATCAGCAGGCCATTTTCCAGAACAAATAAGAGGACAGTCTGATAGGTATATGCGAACAAAGATTGTCCCATGCCTAAAGCCACCTGGGACATCTGATCACTTACCTTTGCCAGGGAAGCACCCGGTAGGGGTCCATTGTTTCTGGTAATCACAGCTGCTTTAGCTGCTGATTTATGCCAGGCAGGTCATGGGGGCAGGTACCTTGGCATGATACTGTGGATGGGGAGTCCCAGATGGGAGGCAGGCAGACGTGCTGATGGCCGGGGCTTCATAATACTTTGCTTTGGTGGAGTTGGTGGTTGGGAGGATCTGAGGAATGCAGGCTGAGCCTTCCAGCTAGCCCTAAGGGCTTCCTGCTCAGGCCTCAGCCTCACCAGGCCAGAGTGGGCAGTGGCAGAAACCTTGACGGTCACTTAAAAGGGTCTTCATCCACCTGAAGCAGAAAAGGCTGTGCCTGTCCTTTGCTTGGTACAAGAGTAAAGCCTTTTATCAAGCCTTTGTCCCCTTGACCTGTCGAACTACGAGAAGCACACTCACCATCACAGGAGGTCAGGCTGTCACTAACACAGCGTCCTTCCATAAAGGCCCCAGTGATATTAAGGGAGTGGTCCTCTGAGACAGCTCACTCGAGTGGTGCTGGGCTGAGGCTGTGGCCTTTGGTCCTGCTCGTGGGTGTTCTCTGCCTGCTTGGCTGGAAGGCGTTAGCAGTAGGAGGACT