Transcript asmbl_52995

Sequence
Transcript Sequence for observation asmbl_52995 of TGE0025044:
GCGGAGGAGGTGGAGGAGGTGCCGGGCGGCCGCTTCCCGCCCCCGAGCGCGAGCCGGTTCCGAGCGGAGTGGAGCGGAGGTCGGACCCGGAGCGGAGCCGGCTGAGCGGGCGCTGAGCCCCCGCCATGGCCCGGAACACGCTGTCCTCGCGCTTCCGTCGGGTGGACATCGACGAGTTTGACGAGAACAAATTTGTGGACGAGCAGGAGGAGGCGGCGGCGGCGGCGGGCGAGCCAGGCCCGGACCCCAGCGAGGTGGATGGGCTCCTGCGGCAAGGGGACATGCTTCGGGCGTTTCACGCAGCCTTGAGGAACTCTCCTGTCAACACCAAGAATCAAGCCGTGAAGGAACGAGCCCAGGGCGTGGTGCTGAAAGTGCTTACAAATTTTAAGAGCAGCGAAATTGAGCAGGCTGTGCAGTCACTGGACAGAAATGGCATTGACTTGCTAATGAAGTACATTTATAAAGGGTTTGAGAAGCCCACAGAAAATAGCAGCGCAGTGTTACTCCAGTGGCATGAAAAGGTATGTGAACACGTTGCCCATGTCAGCAGCCAGCTGACTCACCCCAACCCCAAGGTTCAAATCAGCAGGCCATTTTCCAGAACAAATAAGAGGACAGTCTGATAGGTATATGCGAACAAAGATTGTCCCATGCCTAAAGCCACCTGGGACATCTGATCACTTACCTTTGCCAGGGAAGCACCCGGTAGGGGTCCATTGTTTCTGGTAATCACAGCTGCTTTAGCTGCTGATTTATGCCAGGCAGGTCATGGGGGCAGGTACCTTGGCATGATACTGTGGATGGGGAGTCCCAGATGGGAGGCAGGCAGACGTGCTGATGGCCGGGGCTTCATAATACTTTGCTTTGGTGGAGTTGGTGGTTGGGAGGATCTGAGGAATGCAGGCTGAGCCTTCCAGCTAGCCCTAAGGGCTTCCTGCTCAGGCCTCAGCCTCACCAGGCCAGAGTGGGCAGTGGCAGAAACCTTGACGGTCACTTAAAAGGGTCTTCATCCACCTGAAGCAGAAAAGGCTGTGCCTGTCCTTTGCTTGGTACAAGAGTAAAGCCTTTTATCAAGCCTTTGTCCCCTTGACCTGTCGAACTACGAGAAGCACACTCACCATCACAGGAGGTCAGGCTGTCACTAACACAGCGTCCTTCCATAAAGGCCCCAGTGATATTAAGGGAGTGGTCCTCTGAGACAGCTCACTCGAGTGGTGCTGGGCTGAGGCTGTGGCCTTTGGTCCTGCTCGTGGGTGTTCTCTGCCTGCTTGGCTGGAAGGTGAGCTCTTGGGCTTAGTAGGTGGGGGTGGTGTGGAGACCAAGCCCTTGGGGCCCTTTTAGGCAGCTTGGTGCTCAGCCCTGGTGGCATTTCTAATATGGGCTCAGGAAGGCAGCTGTGATGACCTAGTGTCTTAAGTGCCTGGGGCAGTGCAGCAGGCTGGAAACAATGAGCTTGTCAAAAGGGAAATTGCGGAGTGGGGGGCTCTGCTGTGTGTGTGTGCGTGCGCGCGCGC