Transcript asmbl_52833

Sequence
Transcript Sequence for observation asmbl_52833 of TGE0025036:
CGGAGACGCGGTCTCGGCCCGCGCGGTCCAGACGTACTTGGCTCGCCTGCGTGTGGCCGCGGTTGCGCGTCGACCATGGCGGTTACCGACGGATTGCTTCTCCACCTTTCCGAGCCCCCAGCCGCCGCCGCCGCCTTCAGGACGTTCTCCAGACCCCGCGTGGCCCAGGCGAGGCGGCAAGCACAGGCCACCAAAAGGAAGTACCAAGCATCCAGCGAGGTTCCCTCAGCGAAGCGGAGGAGCAGGGCATCCTCTCTGCCCGCTAAGAAAACCACCGCGGAAGGAGTGCAGAGGGCTCCCGAGGGGAGGGCGCAGACGGCGTCTTCCCCGCGGAGGTCTTCGGCCGGCGGCAGGGGTAGGAACCAAGAGCAGAAGCCATGCGTTAAGACCTCCTCGTTGTTTAAAAACAACCCCGAGATTCCAGAACTCCACAGACCCGTCGTACAGAAGGTGCAAGAAAAGGTGTTCTCTTCAGGTGCTTTTCATGACCTGGACCTCCACCCTCATTTGATTTCCACAATAAACACAGTCTTAAACATGTTCAACATGACCAGTGTTCAGATGCACAGCATTCCCGTGCTGCTGGAAGGCAGAGATGCCCTCGTGAGATCGCAGACCGGCTCAGGTAAAACTCTTGCCTATTGCATCCCTGTGGTCCAGTCCCTTCAAGCAATGAAAACGAAAATACAGCGCAGTGACGGCCCCTATGCTCTGGTGCTGGTGCCCACGAGAGAGCTGGCTCTACAAAGCTTTGACATCTTCCAGAAACTTCTCAAGCCGTTCACTTGGATTGTGCCCGGAGTGCTCATGGGAGGCGAGAAGAGAAAATCGGAAAAAGCCAGACTCCGCAAGGGAATAAATATCCTTATCTCAACTCCGGGGCGACTGGTGGATCACATCAAATCCACAAAGAACATTCATTTTAGCCGGGTACAGTGGCTGATTGTGGATGAAGCCGACAGAATCTTGGATTTGGGTTTTGAGAAGGATATCACAGTGATACTCAATGCAGTCAATGCCGAGTGTCAGAAGCGACAGAACGTCTTGCTGTCGGCGACACTCACGGAAGGGGTGGCCCAGCTCGCCGATATCAGTTTACTCAACCCAGTCAGTATTTCTGTCCTGGAAGAAGGCTACGGACAGGCTAACCCACAGGGCGGAGGAGCTCTTGAAGTCTCCGCTCCACAAACCAGCGACGAGTTGGACAGCTTCGCGATACCGGAGGGTCTCGATCAGCACGTGACCTTGGTTCCCAGCAAACTGAGGCTGGTCTCCCTGGCGGCCTTCATCCTGCAGAAGTGCGCGTTCGCAGCCGACCAGAAGATGATCGTCTTTTTCCCGAGCTGCGAGCTGGTGGAGTTCCACTACACGCTCTTCGTCCAGACCCTGCTGCCCCGCCCGGGAGCCCCGGCCGCGGCGCCCTTACCATCCGGCTCCACGCAGTTGAAGTTCCTGCGGCTGCACGGGGGTCTGGAGCAGGAGGACAGAATAGCCGTGTTTCAAGAATTCTCCCATTCCAGAACGGGCGTTCTCCTTTGCACGGACGTTGCGGCTCGGGGCTTAGATCTCCCTCAAGTCACGTGGATTGTTCAGTACAACGCTCCGTCTTCGCCGGCTGAGTACGTCCACCGGGTTGGGAGAACTGCCCGCATTGGCTGCCGGGGGAGCAGCCTGCTCATTTTGGCTCCTTCGGAGGCAGAATATGTCAACTCGTTGGCTTCTCACAAAATCAATGTTTCCGAGATTAAGATGGAAGATATTTTGTCTGTTCTGACAAGGGATGATTGTTTTCCGGGGAAGCAGTGGGGAAAGCAGAAACCCCGTGCCTTGAGCCCCCAGGGGATCCGAGAGCGAGCCACGGTCTTGCAGACGGTGTTTGAAGATTACGTGCACTCCAGTGAGCAGACGGTCTCCTGGGCAAAGAAAGCCCTGCAGTCCTTCATCCGTGCCTACACCACCTACCCCCGAGAGCTGAAGCACATCTTCCACGTTCGGTTGCTGCACCTTGGGCACGTGGCTAAGAGCTTCGGGCTAAGAGATGCGCCCCAGAATCTTAGCGTCTCGGCCGTAAAAAAGAAAAAAGCCGCCCCGAAAAGGCCTGACCTTCGGAAGAAGACCCAGAGTAAGCAGCGCCTTGCTGAAATCTTGCGTTCCGAATACGCAAGCGGGATGGAGGCTGGCATGGCCAAGGTCAGAAAGCAGAGCAAACAGGCCGACCAGGCAGCCGGCCGAGCGGCACGTCCGAGACCCGAGCCCGGCCTGGGCCGTGGGAAAAAGCAAAAGAAAAAACGCTCTCCGTGAAGGAGAGAAACCCAGAAAGGCTTACGAGGGACGAGACTCCCCAGAAAGTTGCTCTAAACTCTTCCTCCCCAGGACCGGGCCTGTGGCCCTGGTGGCACTGGATCGATGTCCCGCTCTCTTTTCAGAGGAGCCTTGGGACACGTACCAGTGCCACCTGTCCCTGATGACGGGCGTCCCTGCCACAGAGCGGCCACGGCCCCGTCTCCCACGGGGAGGGGTCAGCGGGGCAGGGAGTCAGTGGTTAGCCTGTGTCTTACAGCAGACACCTCACATCTTGTGTTCATTCTGTCAGCGCCCACACCTGCTTCACCCGTAGATCAGATGGTGCCCCCACGACTTAGTGCCTAAGCCTTGTCCTTACGTCAGCCAGGAGAGGCTGCGACCTGCCTGGTGACACGATCTGAAGAAATGTCTGTGTTCCTTTCTCCCGCCCCATCAGCGCCCATATGGGCGTGAATTTTGTAAAGTAAGATATCAAACTCCGGACTTCAATTTGTCAAAGAAGAAAATATTTATCAGATCACCTTCTCGATGTCTAAATGCTCGTGAGAGAGGATGGAAGGGGTTCGGGTGTGAGTCCCCGCGGTCAGCCCTCCTGGTTCCCGTCCGGGCTGCCCCCACCTCCAGACCACATGCGCAGGCATTGCTGGTGCCCCCCACATCCACGGAAAACTGATGCTCAGGACTAATTGACTTGCTGTCGCCGTTTTATCATTCGCCTTTGAAGTCAAAGGCTCCAGTGTCCTGAGCTTTTTCTCTCATGGAATCCGGTCCCCTCCAAGAAAGGCCTGAGGTCTTTGTACTGTGGCCCAGGCCACAGCTGCCCCGCCCCCATTGTGTTTCCTGGGAAGTTTGAAAGGGACCCCCAGGGCGTATTGATTTCCCAATAAATGTAAGATTTGGACACGGGTGACCGCAGAGGGTGCGGGGAGGTGGG