Transcript asmbl_52768

Sequence
Transcript Sequence for observation asmbl_52768 of TGE0005882:
CTGGGATTGAAGAGATATGGCCCCTCCCCTTCCCGGGATGTCGGAAGAAACCCGACAGAGCAAATTGGCCGCGGCCAGGAAAAAGTTAAGGGAATATCAGCTGAAGCAAGGCTGTCTTCCTACAGGACCTAAGAAGAAAAAGAAGATTAAAAATGGCAATAACCCTGAGACACCCACTTCTCATGAGTGTCACTCAGCCGAAGATGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAGCCGGTATCAAGAGCTATCTCTAGCCCTGGACTCCAGCAATCTAACAAACAAACAACTCATTAGCAAGATAGAGGAATTGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGA