Transcript asmbl_52766

Sequence
Transcript Sequence for observation asmbl_52766 of TGE0005882:
CTGGGATTGAAGAGATATGGCCCCTCCCCTTCCCGGGATGTCGGAAGAAACCCGACAGAGCAAATTGGCCGCGGCCAGGAAAAAGTTAAGGGAATATCAGCTGAAGCAAGGCTGTCTTCCTACAGGACCTAAGAAGAAAAAGAAGATTAAAAATGGCAATAACCCTGAGACACCCACTTCTCATGAGTGTCACTCAGCCGAAGATGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGA