Transcript asmbl_52731

Sequence
Transcript Sequence for observation asmbl_52731 of TGE0005877:
CAGAGAAAACTAGGAAGATCCTGACGGAGTTCCTTCGTTTTTACGAGGACCAGTATGGTGTCGCCCTTTTCAACAGCATGCGCCACGAAATCGAGGGCACCGGGGTGCCGCAGGCCCAGCTGCTCTGGCGCAAGGTGCCGCTGGATGAGCGCATCATCTTCTCGGGGAACCTCTTCCAGCACCAGGAGGACAACAAGAAGTGGAGGAACCGCTTCAGCCTCGTGCCCCACAACTATGGGCTGGTTCTCTACGAGAACAAAGTGGCGTATGAGCGGCAGGTCCCACCCCGAGCTGTCATCAACAGCGCAGGCTACAAAATCCTCACATCCGTGGACCAGTACCTGGAGCTCGTTGGCAACTCCTTACCAGGGACCACCTCGAAATCGGGCTCCGCCCCCATCCTCAAGTGCCCCACGCAGTTCCCACTCATCCTCTGGCATCCTTCTGCACGACACTACTACTTCTGCATGATGACAGAAGCCGAGCAGGACAAGTGGCAGGCTGTCCTGCAGGACTGCATCCGGCACTGCAACAACGGGATCCCCGAGGACTCCAAGGTGGAGGGCCCTGCGTTCACGGACGCCATTCGCATGTACCGCCAGTCGAAGGAGCTGTATGGCACCTGGGAGATGCTGTGTGGCAACGAGGTGCAGATCCTGAGCAACCTGGTGATGGAGGAGCTGGGCCCTGAGCTGAAGGCGGAACTTGGCCCCCGGCTGAAGGGGAAACCACAGGAGCGGCAGCGGCAGTGGATCCAGATCTCGGATGCTGTGTACCGCATGGTGTACGAGCAGGCCGCAGCGCAGTTTGAGGCGGTGCTGTCCAAGCTGCAGCTGGCCCGGCCGGCCATGGAGGCGGTCATCCGCACCGACATGGACCAGATCATCACCTCCAAGGAGCATCTGGCCAGCAAGATCCGAGCCTTCATTCTCCCCAAGGCGGAGGTGTGTGTCCGGAACCACGTTCAGCCCTACATCCCGTCCATCCTGGAGGCCCTCATGGTGCCCACCAGCCAGGGCTTCACGGAGGTGCGGGACGTCTTCTTCAAGGAGGTCACCGACATAAACCTGAACATCATCAATGAGGGCGGCATCGACAAGCTGGGCGAGTACATGGAGAAGCTGTCCCAGCTGGCGTACCACCCCCTCAAGATGCAGAGCTGCTACGAGAAGATGGAGCCGCTGCGGCTTGATGGTCTGCAGCAGCGTTTCGACGTGTCCAGCACGTCCGTGTTCAAGCAGCGAGCCCAGATCCATATGCGTGAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGCTGGGGGATGCTGGGGGAGGGGGTGCCTCATGAAGCAGGGTGGGGCCACAGGCCTGGGGATGGAGTAAGAACGGCCTGGAACGTGCTGGTCTGGGGAGAGGAAGTGTCAGAGGGCGGGCAGGAGCGAGCCCTGCCCAGGTGTTACTGGGGGCGGAGGTGTTACCGGGAGGATGTGCCAGCAGGGGGCGAGCGGGCAGAGGGAGCGGAGCTGGACGCCGAGCGGGCATTCGGGCCTCTCTCCCTCCCAGCCCCAGCTGCCGCTGCCCGCTTGCTCGCTGGGATCTAGTCCTCGGGAGTCCCTCCGTTGCCCCTGCCCCTTCTGTACCCACAGACTGTGCGGTGACTTGTTGCTCAGAGGCAGGGTTTAGTGGGTGCGGGTTCTGTCTTCTATGGGCCATCTCCACGGTACGCGCTGTCCACCAAG