Transcript asmbl_52729

Sequence
Transcript Sequence for observation asmbl_52729 of TGE0022160:
CTTTCCTCCAGGGCCCAGGACCTGTTTCCTATTGTCTTGAGGCAGGGACTGGCCCCAGTGCCTAGCACAGTGCCAGCGCACAGTAGGCACTCAGTAATGGTGTGAGGGAGAGAGCACAGTGAGTCCACAGGCTGCCAACTGCTCCCGGGAAGGCCTGGGGTGGCCGGCTGAGGAGCCCCTCGGAGGTGTGCAGGAGGGGCTGTGGTCACTCTGGAACCTTCACGTGCCCTATGGTGTGTCCTATAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGCTGGGGGATGCTGGGGGAGGGGGTGCCTCATGAAGCAGGGTGGGGCCACAGGCCTGGGGATGGAGTAAGAACGGCCTGGAACGTGCTGGTCTGGGGAGAGGAAGTGTCAGAGGGCGGGCAGGAGCGAGCCCTGCCCAGGTGTTACTGGGGGCGGAGGTGTTACCGGGAGGATGTGCCAGCAGGGGGCGAGCGGGCAGAGGGAGCGGAGCTGGACGCCGAGCGGGCATTCGGGCCTCTCTCCCTCCCAGCCCCAGCTGCCGCTGCCCGCTTGCTCGCTGGGATCTAGTCCTCGGGAGTCCCTCCGTTGCCCCTGCCCCTTCTGTACCCACAGACTGTGCGGTGACTTGTTGCTCAGAGGCAGGGTTTAGTGGGTGCGGGTTCTGTCTTCTATGGGCCATCTCCACGGTACGCGCTGTCCACCAAG