Transcript asmbl_52716

Sequence
Transcript Sequence for observation asmbl_52716 of TGE0005876:
GAGACCTACTGAATTCAGGATTTCGTGAGTGAGAACTGTCAGTAATCTCGGTGCGTTCCCGTCCTTCGGCCTGTGGCTGGATTGCTTGCGACGTCCTATCTACCTGCCTGCTGACTGACTGGCCGACAGCTCCGGCAAGATGAAGCTCTCCCTGGTGGCTGCGGTGCTGCTGCTGCTCGGCGCGGCGCGGGCCGAGGAGGAGGACAAGAAAGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCCTGCGTCGGGGTGTTCAAGAATGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGCATCACGCCGTCTTATGTGGCCTTCACTCCCGAAGGGGAGCGTCTCATCGGGGATGCAGCCAAGAACCAGCTCACGTCCAACCCTGAGAATACGGTCTTCGACGCCAAGCGGCTCATTGGCCGTACTTGGAACGACCCGTCTGTGCAGCAGGACATCAAGTTTTTGCCTTTCAAGGTGGTTGAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGCCAAACAAAGACATTTGCTCCTGAGGAAATTTCCGCCATGGTTCTCACTAAAATGAAGGAAACTGCTGAGGCTTATTTGGGAAAGAAGGTTACTCATGCAGTTGTTACTGTACCGGCCTATTTCAATGATGCCCAACGCCAGGCAACCAAAGATGCTGGAACTATTGCTGGATTGAATGTTATGAGAATCATCAATGAGCCTACAGCAGCTGCTATTGCTTATGGCCTAGATAAGAGAGAAGGGGAGAAGAACATCTTGGTGTTCGACCTGGGTGGTGGAACCTTCGATGTGTCTCTTCTCACCATTGATAATGGTGTCTTCGAAGTTGTGGCTACTAATGGAGATACCCATCTGGGTGGAGAAGACTTTGACCAGCGTGTCATGGAACACTTCATCAAGCTCTACAAAAAGAAGACTGGCAAAGATGTTAGGAAAGACAACAGAGCTGTGCAGAAACTCCGGCGGGAGGTAGAAAAGGCCAAACGGGCCCTGTCTTCTCAACATCAAGCAAGAATTGAAATTGAGTCCTTCTTTGAAGGAGAAGACTTCTCTGAGACCTTGACTCGAGCCAAATTTGAAGAACTAAACATGGACCTGTTCCGTTCTACCATGAAGCCTGTCCAGAAAGTGCTGGAAGATTCTGATTTGAAGAAATCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCTACTCGAATCCCAAAGATCCAACAACTGGTTAAAGAGTTCTTCAATGGCAAGGAGCCATCCCGTGGCATAAACCCAGATGAGGCTGTGGCATATGGTGCTGCTGTCCAGGCTGGTGTACTGTCTGGTGATCAAGATACAGGTGATCTGGTACTGCTTGACGTATGTCCGCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCCAGGAACACTGTGGTGCCCACCAAGAAGTCACAGATCTTTTCTACAGCTTCCGATAATCAACCAACTGTTACAATCAAAGTTTATGAAGGTGAACGACCCCTGACAAAAGACAATCATCTTCTGGGAACTTTTGATCTGACTGGAATCCCTCCTGCTCCCCGTGGAGTCCCACAGATTGAAGTCACTTTTGAGATAGATGTGAATGGCATTCTTCGAGTGACAGCTGAAGACAAAGGTACAGGCAACAAAAATAAGATCACAATTACCAATGACCAAAATCGCCTGACACCCGAAGAGATTGAAAGGATGGTTAATGATGCTGAAAAGTTTGCAGAGGAAGATAAAAAGCTCAAGGAGCGCATTGATACTAGAAATGAATTAGAAAGTTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAAAAGCTGGGGGGCAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCCGTAGAGGAAAAGATTGAATGGCTGGAAAGTCACCAAGATGCTGACATTGAAGATTTCAAAGCTAAAAAGAAGGAACTAGAAGAAATTGTTCAGCCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCTCCCCCAACTGGAGATGAGGAACCAGTAGACAAAGATGAGTTGTAGACACTGCTCTGCTAGTGCTATGATGTTGTAAATACTGGACTCAGGAACTTTCGTTAGGAGAAAATTGAGAGAACTTAAGTCTCGAATGTAATTGGAATCTTCACCTTGGAGTGGAGTTGAAAATGCTATAGCCCAAGTGGCTGTTTACTGCTTTTCGTTAGCAGTTGCTCACATGTCCTGGGGTGGGGGGACAGGAAGAATTGGCTATCTTAAAAAGTGGGTAAAAAGGTTGGGTTACGGCATGTGTTCACCATGGAAAAATGTTCTATTTAACATTTGGGTCATGTGCATCTGGTGTAGGAACTTTATTTTCTACCGTAAGTGACATCAATAAATGTTTGTTATTTACACTGGTCTAATTTTTGTGATAACCTTTCTAAGTAGGTCAACCATTTTGAGTTTAGATTCTCACGGTGGGGAGGTTGGGCTTTTAAGGTAAGGAAACATTTTTATTCAATACTTTCAGGGAACTTGCCTAACTTTAAAGAAAAGAGGTGGGAGGTGGGCCATTTCACAATGTGCAAGAGTAGAGTTTTCATGAACATGTTTGAAATTTTCTATTTCTCCTTTCTAAAACTTTTTTTGGTGGCTTTTTATTACTAATGATGCTTTATACCTGCTTTGGAATCTAAGGCTTGATAGATGGATCACTAATGTTAACTTTACATACTTGGAGCAATTCATAATTTTAGGATATAAAGGTCTATTTTGAAACTTAGCTATGTCTGAATCCCCATCTCTGAAATTT