Transcript asmbl_51901

Sequence
Transcript Sequence for observation asmbl_51901 of TGE0025018:
CGGCGCCGGAAGTGAGTGAGCACTTCCGGCGGCGCGGATTTCTCAGTGGTGCCGCTGTCCGGGGATCTTTCTGCCGAAATGAAGGACGTTCCCGGCTTCCTGCAGCAGAGCCAGAGCTCCGGGCCCGGCCAGGCCGCCGTGTGGCACCGCCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTTCTTGATTTTGTGCAGGACCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTCTATGAGAACTTCATCAGTGAGTTTGAACACAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGCGCCCGAGCAGCGAGAGCGAGCATTCACGCTGGGACTGGCGGGACTTCTTGGTGACGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCCGTACTGGAGTCTCTGAGGGGCACTGACCGGCAGTGGCTGATCGACACCCTCTACGCCTTCAACAGTGGCAACGTGGAGAGGTTCCAGACGCTGAAAGCCGCCTGGGGCCAGCAGCCTGACTTAGCGGCCAACGAAGCCCAGCTTCTGAGGAAAATTCAGCTGTTGTGCCTCATGGAGGTGAGCGACCGCCGGGATGGTTTGTGGTGTGGGGCCCTGCAGATGAGCCTGTGCCCCCGCAGGCTCCCCAGCCTCTGGACACAGCAAATTGGTGGCATTGCTCCTGTCCTAACCCTTCTCCACCACCTCCCTTTTCCTCGGCCACCACGTGCTTTTTCAGTTTTGTATTTCGGTCTCGGCTCAGACGACCTCTCAGAGAGGCACCTGACCATCTGAGCTGAAGCGGCTGCCACTCCACTGGCTGTGGAATCCCTTGTCTTCCCCACTGGAATATAAGATTTCTGAGAAAAGAGACTTGGTGTTTCTGGTCACTGCGGTGTCCGCAGCTGCAAGTCCTTGTTCAGGACACAAATGATGACTGGTAGGAGCTGCTAGGGTACTTACTTTCGGCTAAGTACTGGAAGCTTGTTCTCGGTATGTGACTAGCGTTAAGAAAATTTTAGTGTGGTACTAATATCTATATTTTTAGAGCTGGTGTTGATAAAAAATACTCTTATCAATCAGTTCTGACAATTTTTATTAAGAAAAACTTAAAACTTTTTTCAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCAGTGTGAACGAGGTGGAGCTGCTGGTGATGAAGGCGCTCTCGGTGGGGCTGGTGAAAGGGAGCATCGACGAGGTGGACGGGCGGGTCCACATGACCTGGGTGCAGCCCCGCGTGCTGGATCTGCAGCAGATCGCGGGCATGCGGGACCGCCTGGGCTTCTGGTGCAGCGACGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCACGACATCCTCACTTAGCGCCTGCCTGCGGAGCTGCCTCCTGGCTGACGAAGCTGGCGGCTGG