Transcript asmbl_51896

Sequence
Transcript Sequence for observation asmbl_51896 of TGE0005867:
TTTCTGTTTTTGTATTTTTTGGAACTTAACGTTTTCTCCAAATCCAAAATAAATTTGTAGACTTCACATGTGATGAAGCAGAGTAGGTGTAGATGGACTGTGAAGAGGCAGAAAGGTCCTGCCAAACCTAGCTAGCCTGCGTGTTAGTATCTCAAAGGCAAAGACGTGCCACTCTGGAAGGAAGGTGGCCACTTGGGGAAGAGCCCAAGCTTGGGGAGCGGGCCTGAGGGGAAACGCCCGTGCCAGGCGGCTAGTCTGGCCCGGAGACGCAAACCGTTTGAGTCACATAACACACCCCCCGGGTTTGGTCCTGTGCCCAGCAGGCAGCCTTTCGATCCACCTGCCAGGAGATGGTGCCCGTCACACAGAGGCGCATGGCCCAGTGCTCCTGGCAGCGCTGCTTTTCACTCGACGTTAATGACCAGCTCCTTCACTTCAGAGCAAGTCCCTGGAGCTCGGGCCTGTCCCTCAGAGGCCCCACGTGCACCTGGACCCGCTCAGCCCAGGCCATGCCCTTCCCTGCCTTGCCTTGTGCCAGTCACCCTAAATGCCTGCACCCTATGGTCCTACCCCGTGTTTGTGGCAGTCACACATACCTTGTCAACTCCTTGCCTTGGAAAACGGCTGTTCAGCCAGGCCCTTTTCGAATGAGTTTCTAAGAAAAGTTCAAGTGACTCTTTAAAAGCCAGTCATGATCCCCGGGGCCCGCAGTGCGAGATGCTTGAACCGGCCCAGTTTCCTCTTACGCCATCTGGTGCCGTGAAGAAGTTTCACCGCCCAGGTCAGGTAACAAGTGTCCTTCTGCCTTGTAGCCTGACTTAGCGGCCAACGAAGCCCAGCTTCTGAGGAAAATTCAGCTGTTGTGCCTCATGGAGGTGAGCGACCGCCGGGATGGTTTGTGGTGTGGGGCCCTGCAGATGAGCCTGTGCCCCCGCAGGCTCCCCAGCCTCTGGACACAGCAAATTGGTGGCATTGCTCCTGTCCTAACCCTTCTCCACCACCTCCCTTTTCCTCGGCCACCACGTGCTTTTTCAGTTTTGTATTTCGGTCTCGGCTCAGACGACCTCTCAGAGAGGCACCTGACCATCTGAGCTGAAGCGGCTGCCACTCCACTGGCTGTGGAATCCCTTGTCTTCCCCACTGGAATATAAGATTTCTGAGAAAAGAGACTTGGTGTTTCTGGTCACTGCGGTGTCCGCAGCTGCAAGTCCTTGTTCAGGACACAAATGATGACTGGTAGGAGCTGCTAGGGTACTTACTTTCGGCTAAGTACTGGAAGCTTGTTCTCGGTATGTGACTAGCGTTAAGAAAATTTTAGTGTGGTACTAATATCTATATTTTTAGAGCTGGTGTTGATAAAAAATACTCTTATCAATCAGTTCTGACAATTTTTATTAAGAAAAACTTAAAACTTTTTTCAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCAGTGTGAACGAGGTGGAGCTGCTGGTGATGAAGGCGCTCTCGGTGGGGCTGGTGAAAGGGAGCATCGACGAGGTGGACGGGCGGGTCCACATGACCTGGGTGCAGCCCCGCGTGCTGGATCTGCAGCAGATCGCGGGCATGCGGGACCGCCTGGGCTTCTGGTGCAGCGACGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCACGACATCCTCACTTAGCGCCTGCCTGCGGAGCTGCCTCCTGGCTGACGAAGCTGGCGGCTGG