Transcript asmbl_50655

Sequence
Transcript Sequence for observation asmbl_50655 of TGE0005795:
CCGGGCCGCTGCTGGAGTCGCCGCGGCTGCCGCGTGACGTGGCACAGCGAAAGGCTTAATACTAGAGCCGGAGCTGCCGCGCCAGTCGTAGAGCAGGTCCGCGCCCCGCTAGTACCTGACCTGGAGCTTAGTCCGAAACGCCGGCTAGCGGGCAGTTCCTGCCGCCGTCTTTCTTCCTTAGCTTCTTTTTCTCGCTCAGTTTGCCGGGAGCTTGGAAGGAGAAGGCCCGGGGACGCTCTGAACCCCTTCTGCTCCTGCCCATCGCAAGTGCCACTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTTGGCAAGAAACAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAGCTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTTACAGTATGGGATGTTGGTGGTCAAGACAAAATAAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAATGATCGTGAAAGAATTCAGGAAGGAGCTGACGAACTGCAGAAAATGCTTCAGGAAGATGAATTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTTTATGAAGGACTTGACTGGCTGTCGAATGAACTTTCAAAACGTTAAATGAAACTGGATATTTAACCAAGGACACGTTTGATAGAATTGGTCTAGGCTTGTTACAACAAAATTAGTTTGCATCTTGGTTATTAAACAGTATCTGGGACTGGTTTGGGCAGAAGATTACAGCGTTTAAACTTATTTTGTTGCCAATTATTGTTTACCAAGTATAATGTTGCCATTTAGCAATATGCTTGGTTTTAAAGAAATTCTCCTTAACTTGGAAAAAAAAGTGTCCTCTTTTAATTTTACTTCCCTTAAGCCTAAATGCCTGGACATAGCTATTGTGACACCTTTAAATAAATCCGTTTTGAATGTTTTTTGAGCCCACAACAATAATGTTTTAAAGTTTTTCCCTTGCTACTTTACTGATACCTTTATCATTCCTGGGACAGTCTGCTGATTTAAAAATGTAGCATTCCATTTGTATTTATTTTTCTCCCTTGCCAAAAAGATTTTTTAATATCGCTTGTACCAGCCAGGAAATGTTCCAAAACACTATTCAGATCTGTTGCACTGAGGAACTTATTTTTTTGCCTGTCATTGACTCCTGGCTTCCATCAGCCAAGCTTACCTTGGTGCGGTTTGGATTTGATAGCTAAATAGTTCTTTGCTGATTGCAAAGAGTTCATATTGAGAAGAGTTTTTAATACCCAGCAGATTGTCTTTCTTTATATTGTATCTTTTTTATGTTGCATGTTGCTTTTGGTATCAGCCTGACTCTTTACCCAGTGTATGATAGTTCTGCTGATGTTTTATTGTTTATTGGTGAACATATCTTCATTAAGAGTTTTTGGAAAACTCATCAGACTCAAATGAATAAGTTTTCTTCATAACCCATTTGAAATTATTCCTAATAAAATGATAAAATATGTAA