Transcript asmbl_50636

Sequence
Transcript Sequence for observation asmbl_50636 of TGE0005782:
CTGACTCCTCCCGCTTCCGGTGCCGCCGTCGCCGTGCGTCCGTGTTGAGTTTCTGTCTTCGCTGAGCCGCTGTAGTCACCGCGGAGATGCCGCTGGAGAACTTGGAGGAGGAGGGTCTGCCCAAGAACCCCGACCTGCGCATCGCGCAGCTGCGCTTCCTGCTCAGCCTACCGGAGCACCGCGGGGACACGGCCGTGCGCGACGAGCTGATGGCGGCCGTCCGCGATAACAACATGGCTCCTTATTATGAAGCCTTGTGCAAATCCCTTGACTGGCAGATGGACATGGACCTGCTCAATAAAATGAAGAAGGCAAATGAAGAAGAGTTGAAACGGTTGGATGAGGAGCTGGAAGATGCAGAGAAAAATCTTGGAGAGAGCGAAATCCGCGATGCAATGATGGCAAAGGCAGAGTACCTCTGCCGGATAGGTGACAAGGAGGGTGCTCTGACAGCCTTTCGCAAGACGTATGACAAAACTGTTGCCCTGGGTCACCGACTGGATATTGTGTTCTATCTCCTTAGGATTGGCTTATTTTATATGGATAATGATCTCATCACACGAAACACAGAAAAGGCCAAAAGCTTAATAGAGGAAGGAGGAGACTGGGACAGAAGAAACCGCCTTAAAGTATATCAAGGTCTTTATTGTGTAGCTATTCGTGATTTCAAACAGGCAGCTGAACTCTTCCTTGACACTGTTTCAACATTTACATCCTATGAGCTCATGGATTATAAAACCTTTGTGACTTATACTGTCTATGTCAGTATGATTGCCTTAGAAAGACCAGATCTCAGGGAAAAGGTTATTAAAGGAGCAGAGATTCTTGAAGTGTTGCACAGTCTTCCAGCAGTTCGGCAGTATTTGTTTTCTCTCTATGAATGTCGTTACTCAGTTTTCTTCCAGTCGTTAGCTGTTGTGGAACAGGAAATGAAAAAGGACTGGCTTTTTGCTCCTCATTATCGGTACTATGTCAGAGAAATGAGAATTCATGCATACAGCCAGCTGCTGGAATCATATAGGTCATTAACCCTGGGCTATATGGCAGAAGCCTTTGGTGTTGGTGTGGAATTCATTGATCAGGAACTCTCCAGATTTATTGCTGCTGGGAGACTACACTGCAAAATAGATAAAGTGAATGAAATAGTGGAAACCAACAGACCTGATAGCAAGAACTGGCAGTACCAAGAAACTATCAAGAAAGGAGATCTGCTGCTAAACAGAGTTCAGAAACTTTCCAGAGTAATTAATATGTAAAACTATGTAAACAAAGGATTTCCTTTAGAGATAATTATTTCGAATTTTTATAGCTTACTCACTATGTGCCCAGTTCACTTGTATAAAATAAATACTGCATCGTTTCTTTCAATTTACTTTTTTCTTAAACATATCTACATTCTGG