Transcript asmbl_49007

Sequence
Transcript Sequence for observation asmbl_49007 of TGE0005674:
GGGCTGGGAAGGCGGGTACCCCGAAATCGTCAAAGAGAACAAGCTCTTCGAGCACTACTACCAGGAGCTGAAGATCGTGCCGGAGGGCGAGTGGGACCAGTTCATGGAAGCGCTCAGGGAGCCCCTCCCGGCCACCTTAAGAATTACTGGTTACAAAAGCCACGCGAAAGAGATTCTCCATTGCTTAAAGAACAAGTATTTCAAGGAATTGGAAGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAACCCCTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGCGAAAGTCTCCACAATTGGAAAAGTTTCACCAGTTTCTGGTTAGCGAAACCGAATCTGGAAACATCAGTCGTCAAGAAGCCGTTAGCATGATTCCACCGCTGTTGCTTAATGCTCATCCTCACCACAAGATCTTAGATATGTGTGCAGCGCCTGGATCGAAGACCACGCAGTTAATCGAAATGCTGCATGCCGACATGAGCGTCCCTTTCCCAGAGGGATTTGTCATCGCGAATGACGTGGACAACAAACGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGCTGAGCAGCCCGTGCATCATGGTGGTCAACCACGACGCGGCCAGCATCCCGAGACTCAGCGTGGACGTGGGCGGGAGGAAGGAGATTCTCTTCTACGATCGCATCTTATGCGACGTCCCCTGCAGTGGAGATGGCACTATGAGAAAAAACATCGATGTTTGGAAAAAGTGGACCACGTTAAACAGCTTGCAGCTGCACGGCTTACAGCTACGCATCGCCACGCGGGGGGCTGAGCAGCTGGTAGAAGGCGGTCGGATGGTTTACTCCACGTGTTCCCTGAACCCTATCGAAGATGAAGCAGTCATAGCATCTTTACTGGAAAAAAGCGAAGGTGCCTTGGAGCTTGCTGACGTGTCTTCTGAGTTGCCGGGACTAAAGTGGATGCCTGGACTCACCCAGTGGAAGGTCATGACAAAAGATGGACAGTGGTTCGCATCGTGGGACGAGGTTCCTCACAGCAGACACACCCAGATCCGTCCCACCATGTTCCCACCGAAGGACGCGAACACGCTGCAGGCCATGCACCTAGAGCGGTGTCTTAGAATATTACCACATCATCAAAATACTGGCGGGTTCTTCGTGGCAGTATTAGTGAAAAAGTCTTCGATGCCATGGAATAAGCGTGCACCAAAGCTGCAGGGAGACTCTGCGGAGCTGAGGGCGCCTGCGCAGTCCAGCCCTGCAGGTCCCACGGGAGGGACAGCTGCGGGTCCCTCCGAGCTGGAAAGGACACCAGTCACTGGAATGGGTGACGCGGAAGTAATTGAAAGAACTGAGAACTTAGACGATAACGGAAACAAGAAAGACGGCGTGTGTGGTCCTCCTCCATCGAAGAAAATGAAGCTGTTTGGATTTAAAGAGGATCCGTTCGTGTTTATTCCTGAAGATGACCCATTATTTCCACCTATCCAGAAATTTTACGCTCTGGACCCTTCGTTCCCGAGGATGAATTTGTTGACGCGAACGACGGAAGGGAAGAAAAGGCAGCTCTACATGGTCTCCAAGGAGCTGCGGAACGTGCTGCTGAACAACAGCGAGCGGGTGAAGGTTATCAACACCGGGATAAAAGTCTGGTGTCGAAACAACAGTGGAGAAGAGTTCGATTGTGCTTTCCGGCTGGCACAGGAGGGAATATATACACTGTATCCATTTATTAACTCAAGAATCATTACTGTGTCGTTGGAAGACGTTAAAATCCTATTAACCCAGGAAAATCCATTTTTTAGAAAACTTAGCAGTGAGACGTACAGCCAAGCCAAGGACCTGGCCAAGGGGAGTGTCGTCCTGAAGTACGAGCCAGACCCCACGAAACCAGACACCCTGCAGTGTCCCATCGTGTTGTGTGGATGGCGGGGAAAGGCCTCAATTCGAACTTTCGTGCCCAAGAATGAGCGGCTGCATTACCTCAGGATGATGGGGCTGGAGGTGCTGGCAGAGAAGAAGAAGGAAGGGCCTGTCCTGACAGGCGACAGTGCCTCTGGCTCCGGGCCACCGGAGGACGAGGCGAGTGCCGACCGGGACGAAGAGCAGGCTGCCAGTGTGGACGGCGCAGGCGGTGACCCGGCCGGGGGTCCTGGGGCGTCTGCACCCCAGTCCAGAACTGCTGACCTGTAAAGCACGATTTTAACGGCTGGAAACAGACGGGATGGTAGAAGCTTCTGCGAGTGACCGCCGTCCTGCTGTCGCACGGCGTGTGAGGAAAGTATGTTTTCAGCTTGTTCGTTGCTCCTTTTACTTTGTTCTCTGGCGAAGCTGGGCCCAGCGCCTGCTGCCGGTGGGAGGCTTCGTGGTCGAGGTCTCGCTTCCATCAAGAAATGTCACTGCCCACGCAGAAACGTTCAGGTCCCTTCATTACACCTGCATTGGTCTTAAAGTCCAGTATTTCTTTTAATTATTATTTATAGGGAGGATCTGTATGTCCTTACGAGTCGTTGGAAACCATGCTGTAAGCTTTAATAATTGTATTAAGTTGCGTATCAGTGCGACATCGGTGCACAGTGGGTTAATATCCGGGCTGTCAGACGGCTTCTGTGCCTTTATAACAAAGAGTGAAATGTATCCTGTCATGTCAGAGAGACCTGCGTCATGAACTGTGAGGCTCATGAGGGTTTTATGTGCTTTTAGGAAACGAAGCACTTTGCAGTTTTAATTTTTTAATGGGGTTTGGGATGCCTGGAACGTTTAATTAAAGAGACTAATGAAATGTG