Transcript asmbl_48975

Sequence
Transcript Sequence for observation asmbl_48975 of TGE0005670:
AGGGTCGATAAAGATCGGAGCGGTGTGATATCCGACAGTGAGCTCCAGCAAGCGCTCTCCAATGGCACCTGGACTCCATTCAACCCCGTGACGGTCAGGTCGATCATATGTAAGTAACGGCGCGGCGTCTCGCCCACGTGGGCGAACGGCTGTGAGCCGCTTGTCCAGCTGGTGCATCCCTCCCTGTCCCCGCAACCACACCCCGAGCCCCGGGCAGGCGCGAGGCCCGCTCCGCCTGCCGTGTCCCACACCGACACTTTACTGTTGGTTTCCGCACCTTCGAGGTCCCAGTCCCGGAGACCGCAAGTGCCCACGGGAGGGGGCTCCGGCCCTTGGCTGCTCACCCGCATCATCGCCCGGTGAAAGTCAGTGAATCGTAGAGCGCTTCTTGCCAAACCAGGAGCTGGAATCACGGTCTCAGTTGACCTCGCTCCCAGAGAAGACACCAAATGACTTATTGTTGTTGTCCTTAGAGCAGTAGTGCAGGCTGAGTGTGTACACGTGTATGTTAGCCGTCTTGCAATTGTATGTAAATGGGGCTTTCGGTTCTTTTGTATTTGGACCTGGAATTGGGCTGGTATCTTAAAATGCAAGGCAGGTCTTGCCGAGAAAGCAAAGCCAGTAGAGTCTTTGTCCTCGGAGGGGGCTCTCCCGGCCACGGGCTCCTCCGAGCCTCCTGGAGGGCAGAGGGGCGCTCCAGGCCCAGAGCTAGGGGCTGGGCGCTTCACTGCCCCTCGGCATCTGCCTGGCAGAGCAGGCGCTCCCTCCCCCCCGTGGTCGTGCTGCCAAGTGAGGCCTTCTCGTTACTGTGGCTCTGATGGTGGGTTTTGCTTGCACGTTCCTTTTCACGGGGGCTGTGGATGGGTGCCAGTCCCCACGCCCCTCACTCTGCCCGTGAGCATTGATCAGCAGCACTTGGGGATTCGCTCGCCAAGCACCGTGCTGGTCCTGTGCTGGTCCCATAGGAAACTAGGGCTCTGGGGACACGGGGACATGGCGGCGTGGGTGCGGGCCCTGCCGATCGACCCCAGGGTTGCGTTTGCCACGCACCACTGACGCCCCTTTCCGTCTCAGCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTC