Transcript asmbl_48969

Sequence
Transcript Sequence for observation asmbl_48969 of TGE0024895:
TACGCAAGGCGGGTGTCACTCAGAAACGCAGAGCGAAGGCGGGGTCCTGACCGGAGCGCCTGCCTCTGGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGTCGAACATCATTGCCTGGCTGCGGAAAGCTCTAGAAACAGACAAGAAAGACTGGGTAAAAGAGACGGAGCCAGAAGCCGACCAAGACGGGTACTACCAGACGACGCTCCCGGCCATCGTCTTCCAGATGTTCGAACAGAATCTTCAAGTTGCTGCTCAGATAAGTGAAGATTTGAAAACAAAGGTGCTCGTTTTGTGTCTTCAGCAAATGAATTCTTTCTTAAGTAGGTACAGAGACGAAGCCCAGCTGTACAAGGAGGAGCACCTGAGGGACCGGCAGCGCCCACACTGCTACGTGCAGTACATGGTCGCCATCATCAACAACTGCCAGACCTTCAAAGAATCCATCGTCAGTTTAAAGCGGAAGTATTTAAGAAGCGCAGGCGAAGACGGCGTGTCCGTGAGCCAGCCGAGCATGGACGGCGTCCTGGATGCCATCGCCGACGAGGGCTGCCGCAGCCTGCTGGAGGAGGTCTTCCTGGACCTGGAGCAACATCTCAGTGAGCTGATGACAAAAAAGTGGCTGTCGGGATCGAAGGCTGTAGACATCATCTGCGTCACCGTGGAAGACTATTTCAATGATTTTGCCAAAATCAAAAAGCCATATAAAAAGAGGCTGACGGCCGAGGCGCACCGGCGCGTGGTGGTGGAGTACCTGCGGGCCGTCATGGCGAAGCGCATCTCCTTCCGGAGCCCCGAGGAGCGCAAGGAGGGCGCCGAGCGGATGGTCAGGGAGGCTGAGCAGCTCCGCTTCCTGTTCCGGAAGCTGGCTTCCGGGCTCGGCGAAGAGGCGGATGGGTACTGCGACACGATCACGGCCGTCGCAGAGGTGATAAAGCTGACGGACCCGTCCCTGCTGTACCTGGAGGTCTCGACTCTGGTCAGCAAGTACCCGGACATCAGGGACGAGCACATCGGCGCGCTGCTTGCCATGCGAGGGGACGCCAGTCGGGACATGAAGCAGACCATCATCGAGACGCTGGAGCAGGGCACCACACAGGCGAGTCCGAACTACGTGCCCATCTTCAGGGACATTACGGTCCACAGTCTGAACGTCACCAAGCTCCTCAAATAACTTGTCTCGCCCCGAGTCTGCCCCACCCTCAGCAGTGCGTGACTCTGGAGGCCCAGCGCTCTGGTGGCAGGCCCTGGCCCTGGCCCTGGCCCCCCCCCGGGTCAAGAACGACGTTGCGAGCAGACCCAGGTGCCTGTGCCCCGCGCGCGTCGGCGCTTGTGTAGCTGCTGCTCAATAAAGGCACCGTGGAGCGAGG