Transcript asmbl_48455

Sequence
Transcript Sequence for observation asmbl_48455 of TGE0005644:
GGAAGGAACTTCCATAAAGTCATTTCCGGGAAGCGGGGTCGCGCTTTGTTCGCTGCAACATGGAGGCGAGTGGCGGAGCCGATGAGGCGGTTTCCGGGGAATTGGTGTCGGTGGCTCACGCTCTTTCTCTCCCCGCCGAGTCTTATGGCAACGATCCTGATATCGAGATGGCTTGGGCCATGAGAGCAATGCAGCACGCCGAAGTCTACTACAAGCTGATTTCATCAGTTGACCCACAGTTCCTGAAACTTACCAAAGTGGATGACCAAATCTATTCTGAATTTCGGAAAAATTTTGAGAATCTCAAGATAGATGTATTGGACCCAGAAGAGCTCAAATCGGTATCAGCTAAAGAGAAGTGGAGGCCATTCTGTTTGCAGTTTGATGGGGTTATAGAAGACTTCAACTATGGTACTTTGCTGCGACTGGATTGTTCTCAGGGCTACACTGAGGAAAACACAATCTTTGCCCCCAGGATACAATTTTTTGCCATTGAAATTGCTCGGAACAGGGAAGGCTATAACAAAGCAGTTTACGACAGTGTTCAGGACAAAGAAGACAAAGGGGCCAACAATGGCGAAAAAGAGAAAAGCGACAAAGGAGAAGAGAAAGAGAAAAAAGCCAAGAATGGAGTCAATGAAAGCGACGAAATAGCTATGTAAGGTAGACAGGGGACAGCACTCTAGAAACTGTGACTCGGCGGAGTCTACAAGTACCATGATGTTACTTGCACAGAACCCTACGGTTAAAGGTACGCCCTGTGCAGTCGAAGGCCATCTTTCTAGCCTAATAATCAGGAGCTGTTCTGATTGTTCTCTTGTAGGAATTGGCTTAAAGGCTATTAGTGGAGTCATAGTGGATTGTTTCTTGTTATATTTTTTCTTGTTATTTTTTTTCCACCAGTTACGTAA