Transcript asmbl_48257

Sequence
Transcript Sequence for observation asmbl_48257 of TGE0005638:
GGAAAAGGTGGGTTTCCGGACGCTGCACCTGCCTGGGTGTAGGTGTAGGTGAGCCGCAGTCTCCGCGAGACCTTCCAGAATTATAAAGCTGTCCTCAGAGATCCGAAAAATGGCAACAAATGAAAATGTCAGCATCTTTAGTTCAGCGTCCTTGGCTGTGGAGTATGTAGATTCACTGTTACCTGAGAATCCTCTGCAAGAGCCATTTAAAAATGCTTGGAACTATATGTTAGATAATTATACAAAGTTCCAGATTGCAACATGGGGATCCCTGATAATTCACGAGGTCATTTATTTCTTGTTCAGTTTACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAGGCCAATGGAAATGCTTTAAAGTACTTCTCTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACAGAGTATTTCAATATTCCTTATGATTGGGAAACAATGCCAAGATGGTATTTGCTTCTGGCAAGATGCTTTGGTTGTGCAGTGATTGAAGATACCTGGCACTATTTCTTACATAGGCTCTTGCACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGAATGGAAGCTGAATATGCACATCCCCTTGAAACGCTAATTCTTGGAACTGGATTTTTCATTGGAATTGTTCTTTTATGTGATCATGTAGTTCTTCTTTGGGCATGGGTGACCATTCGTTTGCTAGAAACTATCGATGTCCACAGTGGTTATGATATTCCTCTCAACCCTCTAAATCTCATCCCATTCTATGCTGGTTCTCGACATCACGATTTTCACCACATGAACTTCATTGGAAACTATGCTTCAACATTCACGTGGTGGGATAGAATTTTTGGAACAGACTCTCAATTTATTGCCTACACTGAAAAGATGAAGAAGATTAAGAAAAAGGCTGAATAAATATCTATGTAAACCTTCCTGAAGAAACACATTTTCCTGGATTAAAAGTAGTAGCTAACATTGCTTCTGGGGAGCAGAAACAAACATGTCTTGGCTGCTAAGTGATGGAAAAAAATTAACAACCTTTATCTTCCTAGTGGGAACTTTTTCTATTTTCCATTCAAGTTCTGTATGTGTAGAAATAAGAAAGGAAGTTTTAAAGGCCGTGTTGCTAACTTTACAAAAAGATTTGTGTAAAGTAAATGGAAAAAGGATTAACCTGTCTGTCCCTACCATTAATACTATAGACCTGAAGTTGAAGTTGGTCTTTAAATCTTAGTGGCCATTTTAACAACTTTTATTAGTGAATGTTGACCTCATCTTGAACTTTAAACGTTTTTTAGAATTTGCCTAAAGATCAAAATATGGGATGAATGACATCAGTTGATACGATGTGAGTGGGGCTGCAAAATCAGGAATAGCCAACACCAAGAATTTCTACTCTTGTCTGGAGCTGACCGATTTGGGGTGATTTTCTTTGAGAAGTCCTTTTGGGTCCCTACTATTGACATCTATAAATTAAAGCAAATCTGAATCGATGTAAGTGGAATATTTTAGTCTAAAGGTTTTCAGGTTTCTTGAATTTTAAATAAATAAATAAATAAACCTTTATTTCTGCCACTTACTGTTTAATATTTGAAAATCAGGTTTTTATTATACTTAAAACTGTATCTTAAAATTTTGTGAACCTACTTGGTGTATTTGCACTTTGAGCTACTGAAATAAATGTGATTTTTTTGCGTCTGGTTATCTGGTCTCCAATTTTGAACATCAGCTGTCACTTTTT