Transcript asmbl_8926

Sequence
Transcript Sequence for observation asmbl_8926 of TGE0003481:
GCAGCCGCGCCGCCGCGCAGCGCCCCAGCCACACGCCGGCGGGCAGAAGCCGCCCGCTCTCCGGAAAGTGATAACAGAATTCATTGAAGTGGAGAATTTTTAAAGAAGGTAACAAAAAGAGAAAGAAAATGCCGAAACCAATCAACGTAAGAGTAACTACAATGGATGCTGAGCTGGAATTTGCCATTCAGCCCAATACAACTGGCAAACAACTTTTTGACCAGGTGGTGAAAACAGTTGGTTTGCGTGAGGTCTGGTTTTTTGGGCTGCAGTATGTAGACAGCAAAGGTTATTCTACATGGCTTAAACTAAATAAAAAGGTAACACAGCAGGATGTTAAAAAAGAGAATCCTTTACAGTTCAAGTTTAGAGCTAAATTCTTTCCTGAAGATGTTTCTGAGGAATTAATTCAAGAAATAACCCAGAGACTCTTCTTCTTGCAAGTTAAAGAAGCCATCTTAAATGATGAGATATATTGCCCGCCAGAAACTGCAGTTCTTTTGGCTTCCTATGCTGTCCAAGCCAAGTATGGAGATTACAATAAAGAGATTCATAAGCCAGGCTACCTGGCTAATGATAGACTCCTACCCCAGCGTGTATTGGAACAACACAAACTAACAAAAGAACAGTGGGAAGAAAGAATACAGAACTGGCATGAAGAACATAGAGGAATGTTAAGGGAGGATTCTATGATGGAATACCTGAAGATTGCACAAGATCTAGAAATGTATGGAGTCAACTATTTTGAAATAAAAAATAAAAAAGGAACTGAATTGTGGCTAGGTGTTGATGCTTTGGGTCTGAATATTTATGAGCATGACGACAAGTTAACACCTAAAATTGGTTTTCCCTGGAGTGAAATCAGAAATATTTCATTTAATGACAAAAAATTTGTTATAAAGCCAATCGACAAAAAGGCACCTGATTTTGTGTTTTATGCACCTCGTCTGAGAATCAATAAGCGGATTTTGGCCTTATGTATGGGAAACCATGAACTATACATGCGAAGAAGGAAGCCTGATACTATTGAAGTACAACAGATGAAGGCTCAGGCTAGGGAGGAGAAACATCAGAAGCAGTTGGAAAGGGCACAATTAGAGAATGAAAAGAAGAAAAGAGAAATAGCAGAAAAGGAAAAGGAAAGAATAGAACGTGAAAAGGAAGAGCTAATGGAACGTCTAAAACAAATTGAAGAGCAGACAATTAAAGCTCAGAAAGAACTAGAAGAACAGACTCGAAAAGCTCTAGAACTGGATCAAGAACGAAAACGAGCAAAAGAAGAAGCAGAACGACTTGAAAAGGAGCGTCGAGCTGCTGAAGAGGCAAAGTCTGCCATAGCAAAACAAGCTGCCGACCAGATGAAGAATCAGGAGCAGCTAGCAGCAGAACTTGCTGAATTCACTGCCAAGATTGCACTTCTAGAGGAAGCCAAGAAGAAAAAGGAAGAGGAAGCTACTGAGTGGCAACACAAAGCTTTTGCAGCCCAGGAAGACTTGGAAAAGACCAAAGAAGAGTTAAAAACTGTGATGTCTGCCCCCCCTCCACCTCCACCACCACCAGTCATTCCTCCAACAGAAAACGAACATGATGAACACGATGAGAATAATGCTGAAGCTAGTGCTGAATTATCAAATGAAGGGGTAATGAACCATAGAAGCGAGGAAGAACGTGTAACCGAAACACAGAAAAATGAGCGTGTTAAGAAGCAACTTCAGGCATTAAGTTCAGAATTAGCCCAAGCCAGAGATGAAACCAAGAAAACACAAAATGATGTTCTTCATGCTGAGAATGTTAAAGCAGGCCGTGATAAGTACAAGACTCTGCGACAGATTCGACAAGGCAATACAAAGCAGCGTATCGATGAGTTTGAAGCAATGTGAGAGCTGTTATTTTGCATATATGTTCTTCATAAGCTGAACCACCAACAGAGAAAAGCAGGCCTTTGCAGATATGATGGAATGCATCCCACCTTGCCAAAGCACTTACACCAGTTTGACTGTGCTAGCTAAAAGACAAATTTAAGGGGAGCTCTTCAACATTAAGGCAGTATGATATCATGCTTGGTTTTCTTTTTTCTTTTGGTCCAGGGAATGGAGAATGGTGTTCCATTGCCTCTTTTCACATTTTTTTTCTTTTTCTTTTTTTTTTCT