Transcript asmbl_47152

Sequence
Transcript Sequence for observation asmbl_47152 of TGE0005575:
CTCACATTTCCCTTTCTTCCTGTCTGGCTGAAAGATGGCGTCTCGCAAGGAAGGCACCGGCTCTGCCACCACCTCTTCCAGCTCCACCACAGGTGCGGCAGGAAAAGGCAAAGGCAAAGGCGGGTCTGGAGATTCGGCCGTCAAGCAAGTGCAGATAGATGGCTTGGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACTGAGGTGGTTCAAGGAGTACTTTTGGGCCTGGTTGTAGAAGATCGGCTTGAAATCACCAACTGCTTTCCTTTCCCGCAGCACACAGAGGACGATGCCGACTTTGACGAAGTCCAGTATCAGATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGACCACCTCCACGTGGGCTGGTACCAGTCCACCTACTACGGCTCGTTCGTCACCCGGGCACTCCTGGATTCCCAGTTCAGTTACCAGCATGCCATTGAAGAATCTGTCGTTCTCATTTACGATCCCATAAAAACTGCCCAAGGGTCTCTCTCACTGAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAGAAGGATTTTTCCCCTGAAGCATTGAAAAAGGGAAGTATCACCTTTGAGCACATGTTTGAAGAAGTGCCGATCGTAATTAAAAATTCACATCTGATCAACGTCCTAATGTGGGAGCTTGAGAAGAAGTCAGCTGTGGCAGATAAACATGAATTGCTCAGTCTTGCTAGCAGCAATCATTTGGGAAAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATATAACACATACATGAGGAACACGAGTAAACAGCAGCAGCAGAAACACCAGTATCAGCAGCGTCGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGGGAGCCCCCGCTTCCTGAGGAGGATCTGTCCAAACTCTTCAAGCCTCTGCAGCCTCCAGCCAGGATGGAGTCTCTGCTCATTGCAGGCCAGATTAATACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAACTCTTCATGGCCCAGGCGCTTCAAGAATACAACAACTAAGAAAAAGAAGTTTCCAGAAAAGGAGTTAACATGGACTCTTGAGATCACATTGGGGCAACTCTTGGAAGAAATATGTTTGCATACTGAAAAGTCTTTTTAGCCAATAATAAAGTATAAATAAAACA