Transcript asmbl_4642

Sequence
Transcript Sequence for observation asmbl_4642 of TGE0005329:
GTGGCAACGGCGGCAGCTGTGAAGGTGTTCCGGGAAGATGGTGCTGATCAAGGAATTTCGTGTGGTTTTGCCCTGTTCTGTTCAGGAGTATCAAGTTGGGCAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAGAATGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACACACAAAATCTATCACCTAAAGAGCAAAGTTCCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTATTTCATGAGAAAGCCTGGAACGCATACCCCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATTGAAACATGGCACAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTTGAAATTGTCCACATAGATATTGCAGATCGAAGTCAAGTTGAACCAACAGACTACAAAGCTGATGAAGACCCAGCATTATTCCAGTCAGCCAAGACCAAAAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCAAACAACCCAGACTGTCCTCAGATGTGTGCCTATAAACTGGTGACCATCAAATTCAAGTGGTGGGGACTGCAAAGCAAAGTAGAGAACTTCATTCAAAAGCAAGAGAAAAGGATATTTACAAACTTTCATCGCCAACTTTTTTGTTGGATTGACAAGTGGATTGATCTGACAATGGAAGACATTAGGCGAATGGAAGATGAAACTCAGAAAGAACTAGAAACAATGCGTAAGAAGGGTTCCGTCCGAGGCACGTCGGCTGCTGATGTCTAGATGAGTCCCCTGTAGGGTCAGAGACAATATCAAACTGTTTACGTAATCAAGGTCAAGTAAGGGGAACAAGTGCAGCCAGTGATGAGTGAAGAAGAATCTGAACAGTATCTTGCAGTATTGGTGTTTCCCAGACGTGTGCTTGTGACTATCTAGTCACATGCACAGGTTCCCAGCCATGTGTGTATATATGTTTGTGTGTGTATATCCGTAGCTGTATATAAAATGCATGTAGAGCTACAGATCAGAATACACACACGTGTATATATATGTACATATAAACATACCGAAGGGATTAGTACAATTTCTCTTAAGTACTGTACCTATCTTCAGCAAGAATGCAAAAGAATATTTTCAATATGTATACCTGGAACAGATTTTAATAATCAGAGTAATATCATGAATGGACAAATTGACTGCAGTGTGATACTAGCTAGTATGTTTCATAAATGTCAAGTTGTGGACCAATATATACATATATAAATATATAGCCTTTTATTACTTTCCTTTTAAATCAGTCTCTTATAAATTTTTATTTCAGTCTCATAAGCAACAGACGCCCACAGAAAAATTATTCAAAATCTTTTTGCTATCAGCGAACGTAAACTCTGAATGTACATATAACGGTTTCTTTCTGGATGGTCATTATCTTACAGCCAAATTGGACAATATCTATTAGTAAGGAGTAAAGTTATAGGCCAGTTTTTACTTGTTTGCTTTGAGGGACAAAATCCTTTTAAAAAATTACTGGTTTTTATTGGATTTTTGTATTTAAATTTCAAGTATTTTTCTACATCAGACACAGCAAAAATGAGATGATGGTTTGTGATGTATAATAAACACGATACAATTTTTAGGCTCCTGTGAGTCAAACAAAGAAATTAATGAAGAAATTAATAGCATTGTAGGCTGTTTAGAAAAATTGGAAGTACAAGTGCTTCCACAGAGTCTTGTTTTTGAAATGACTGTTTTCTGAAATTACAGCTTGGAAACTATGCAAATGATTTAGATTCCTCACAGCTTACACGATAGACTATAGATAGTGATGATGTTTTGCTCTTTTCATGTTGAAACACACTTTAAGGGGGAGATGCTGACTTTGAATTAGGAAGAATTTAAGAGGCAGCTTGAGGCTCGCCTGCACACAGGAGGCCCTGCCCAGGAGCCGGTGCACCTCCACCCATTTGGCTGTGCTCTCAAGGAGGATGTCGTTGGAACATACCCTGAATAAGCATCGTGAAAACGCTGGTTAGAAGCTGCTGCTGCTGCCTTATTTTATTTTATTTTTTAAGAGAGGAACAATAGGTAAGATTTTTATCAGCTTTCTCTGTCCAAGTCCAGTTTTTCTCCTGTCAGTCCTGAAAGCTTGAATAGAATGATATTGTTGAAGCCTTCAGGTCACAAACTGTCGTCTTAACCTCTCGTCCCTCCTACAACACGCCAGCCCCTGTAGTCACATCACATTAGTAATCTGATTTGCTGACAGTCCTCCCCCCCCGCCCCCGCTTCTCTTTTCCCACATGTCCTGTGTCCCCAACAAAGTGATCGTAGTGACTGAGACAAGGATGTCTTCTGCATTACGATACCCTGTTATCCTCAGCCACAAACCCCACATTGCATATGTCCTCTGTGTACTCAGGATCAAGACTGATGTTTACTCTCTGGGCGCTATTGTAAGATAGGTTTTGTCAACACATAATCATTGTCTGCAAAGTGATGCAAGGAAGGAAGATTATTGCTAATTTTGTGAAATAAAGAGTCTAGCCCTCTCCTTTTAATGAACTTAACTCTCGCTGGCATCTGTAGCATCATTGGGAGCTTGGGCACACATGGAAATGAGAACCCAGCGCATGGATTTTAATGTTTTTCTAACAACTGTGGAGATTTGAGGGAATGTGTGGTGAATGTAAAATATCTAGTTTACTTGGCAGTCTCTTGTGTAAATTACAGTAAAATAAAGTAAATGAAATTTAAACAAAAAATAAATTTGATCACAAAA