Transcript asmbl_4602

Sequence
Transcript Sequence for observation asmbl_4602 of TGE0024799:
TTTCCCTCTCTGTCCCCTGTCTCCATTCTGTGACTGTGTCCAGGTCTGGATATCGAGAGCAGCTTGAAACAGTTGGCTGAGCGGCGTACCGACATCTTCGGTGTAGAGGAAACAGCCATCGGCAAGAAGATTGGTGAGGAGGAGATCCAGAAGCCAGAGGAGAAGGTGACCTGGGATGGCCACTCAGGCAGCATGGCCCGGACCCAGCAGGCTGCCCAGGCCAATATCACTCTCCAGGAACAGATTGAGGCCATCCACAAGGCCAAGGGCCTGGTACCAGAAGACGATACCAAAGAGAAGATCGGCCCCAGCAAGCCCAATGAAATCCCTCAGCAACCACCACCTCCGTCTTCAGCCACCAATATCCCCAGCTCTGCCCCACCCATCACCTCAGTGCCCCGGCCACCTGCAATGCCGCCCCCTGTCCGTACCACAGTTGTGTCTGCAGTACCCGTCATGCCCCGGCCCCCAATGGCATCAGTTGTTCGACTGCCCCCAGGCTCTGTGATCGCCCCCATGCCGCCTATCATCCATGCACCCAGGATCAACGTGGTGCCTATGCCTCCCTCAGCCCCTCCTATCATGGCACCCCGCCCACCCCCCATGATTGTGCCAACAGCCTTTGTGCCCGCTCCACCTGTGGCACCCGTCCCAGCTCCAGCCCCAATGCCCCCTGTCCACCCTCCACCTCCCATGGAAGATGAACCTGCCTCCAAGAAACTGAAGACAGAGGACAGCCTCATGCCTGAGGAGGAGTTCCTTCGCAGAAATAAGGGTCCAGTGTCCATCAAAGTCCAAGTGCCCAATATGCAGGATAAGACAGAATGGAAACTGAACGGACAGGTGCTGGTCTTCACCCTCCCACTCACAGACCAGGTCTCTGTCATCAAGGTGAAGATTCACGAAGCCACAGGCATGCCTGCAGGTAAACAGAAGCTACAGTATGAGGGTATCTTCATCAAGGATTCCAATTCACTGGCTTACTATAACATGGCCAATGGTGCCGTCATCCACCTGGCTCTCAAGGAGAGAGGTGGGAGGAAGAAGTAGAAGAGAAAAACCTCCTCTCAGGTTCCAGCCACTGCCGTTTTGCCTCTCCTGTCCCCCACCCCTTCCCTCAGACCCAGAGGACCCTGCCTTGTACATTTATTTCCCTACTAAGTTTGGAAATTCATATTGTCAAGCAGAGTTTCCTCCTCCCACTCCTTCCTCACATTGACAAGAGGGCTTTCTATGCTGCTCTTCTCCCTAGTGGTGTCCAGAATTCCTTTGTGTTCAGGTCTTGATTTGAGGGGATTCATTTCTTCAGGCAGCCCATTAGGAAATGTGAATCCAGAGATGTCCCGCAAGATAGTGTTGTAGTGCAAAGTGGCACTTGGTTGATAGAATATGCTTACTGTCGTCATTAATCATTTTGTGTCTTGCCATGAGCTGTCTAATAAACCTCTTGGACCTTTCTTGTGAAATCAGTGTCTTTAAGAG