Transcript asmbl_45950

Sequence
Transcript Sequence for observation asmbl_45950 of TGE0005521:
CGGGGGTGCTAGAATCTGGGGCTCAACGTTGGTCTCTTGGGAATGTGGAGAGCTGGCAGCATGTCGGCGGAGCTGGGAGTCGCGTTCGCTCTGCTGGCAGTGAACGAGCGCGTGCAGCAGGCGGTGGCACGGCGGCCGCGGGATCTCCCGGCCATCCAGCCCCGGCTAGTAGCCGTCAGCAAAACCAAACCTGCAGACATGGTGATTGAGGCCTATAGTCATGGCCAGCGCTCTTTTGGGGAGAACTATGTTCAAGAACTGCTAGAAAAAGCATCAAATCCTAAAATTCTGTCTTCATGTCCTGAGATCAAATGGCACTTCATTGGCCACCTGCAGAAACAAAATGTCAACAAATTGATGGCTGTCCCCAATCTCTTCATGCTGGAAACAGTGGATTCTATGAAGTTGGCAGACAAAGTCAACAGTTCATGGCAGAAAAAAGGTTCCTCTGAAAGGTTAAAGGTTATGGTCCAAATTAACACCAGTGGAGAAGAGAGTAAACATGGCCTTCTACCTTCAGAGACAGTAGCCATGGTGGAACACATAAATACCAAGTGCCCCAGCCTGGAATTTGTGGGGCTGATGACCATAGGAAGCTTTGGGCATGATCTTAGTCAAGGACCAAATCCAGACTTCCAGATGTTATTGTCTCTCCGGGAAGAGCTATGTAAAAAACTGAACATCACTGCTGACCAGGTTGAGCTGAGCATGGGCATGTCCATGGACTTCCAGCATGCAATTGAAGTAGGATCTACGAATGTCCGCATTGGAAGCACCATTTTTGGAGAGCGAGATTACTCAAAGAAGCCTGCCCTGGACAAGTCCGCAGCAGACCTGAAGGCCCCCATAGAAGTAACACAGGCACACTGAGCCAAGGAACAGCCAGCAGTGGCTCACAGCCTGTGGCCCTGTCCAGGAAGACTAACTATGCACCCATCTGGATTTTCATTTTGATATTCCCTAAGTTACAGCACAACCATGCTCTCTTTGTGACCTGGAGAGAGTGTGCTGAGGATTTTGTGTGCTGATGGAAATCTTCTGTATTTAGTGTCTGACATAGGGAGCTCGCTTCAAGTAATGGCCTTTGGATTGGATTTGAGAAATCCAGACATTTCTGCAGATATAAAATCAATAGGCAGGAATTGAGTTCAATATTAAATCCTGCCTGGGAGCACCAACTGACACATCAATGCCTTTCCCAGGTTAATATTTGGTCACTGGTGCCTATAATCTCCAAAGTCAGAGGGATTCCCATTTGTCGTTCACTTTAATAGAAAATTCCCTGTGGTTACAGACTCCATACAAACCCCTACTGAGTAATCATCTCTGCTGCCCTGGAGGAAGGTGATTTCTTCCCCGCCCCGTA