Transcript asmbl_45923

Sequence
Transcript Sequence for observation asmbl_45923 of TGE0005515:
GAGGCCTTGGGCTGCCTTGGGCGGTGGATGGGACTGCGGGGCTGGAGGCCTGGAATCCTGGGTCCAGGCCAGAGATCTGACCCGTGGTTGGTGTCCCCCGAACCCTCAGCGTGGCCCGTCTTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGGAAAGTATTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCCGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTTGGGGGTCAATCATATCTTGAAGGCTGTTTGGCTTGTTTAACAGCATATACCATCTTCTTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATATATGCTCCCCAAGGCCTCCTCCTGACAGATCCCATTGAGAGAGGACTTCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACATAGAATTAAAGATCCCAACTCTAGCTGGGACCCTCATCTGTCCACTGGCCAATCGCAGAGTGTCCCCTACCTCCTCTCCAGAGCGTCATTCCTTTGTATCTGCTGCCAGAGCCACGGTGCCATTTCCTCCAAGGACTAACTTTCTAATATTCCACACCTGGAGTGACCTCTCGTCGCTCAGCATCCACTTTATGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCATTTCACTTTTTTATTCAAAGCCATTAATAAAATATGTAGTTAGTCAGCCCAACTCAAAGTTTATTTCTTATCTGCCACCAGTCCCAAATGGTTCTCGTCATTCCTTGGCCCAGCTTCCCAGGTGGCTGTAGACTTCAAAGTGATGTTAGCCAGTGTTCAGTCTTATTCCCCAAATAAAATGCTTTACTCCAGGATTTCAGTGAAGGGTAGGCTGTGTCTGTGGTTTTGCTAATGCATGTCCCAGATTTCAAAGAACTACCAGTTTTGCCATGACTCAAATCTTAAAGATGTTTCTGCCATTCAGTTTCTCAAACTGAAGCTCATTGGAAAAATAATGTGTAATGTTATTTGTTTTATTATAGCAATTATTCCTAATTAAAGCAGTATTAAATGCAATTTCCAGTTATTTTTCTTTGGAGAATTTTGTTATTATTGTATTACCTTGAATGTTGAGAAGATGTGGTATGTGTTGCTTGTTCCTTACAAAAATAAGCACAATAAAGTGGATGCTAAACCATCAGACACATAAATGTCCCTGCTGTTTCCCTGAAAGTGTAATAAGCAAGTATAATAAATATTTTAATTATAGTTTTGTTATAAATATAACTTATGAGAAAAAATTTGATAGGAATAATACTGTATATTGCTAATTTTTAACTATCTCTGCTGGCAAACCTTATTCATAGACTCTCATATACAGTATTCAATGCACAGAAATCTTATGATTGGTTCAAGTACAGTAAGTTAAGTAATTTCCAACTAAAACTCAAGTCTGAGTCAACATTTCTAGTTCCTTTGGCCGTATGTTCTCAGCATCAGGGCTTCTATGCCCTTCATTCACACATGGGCTTTGAAAGAGAGCACCATATTTGGGAGAGAGTTAAGAAATATTTTAGGAGAGAATGAAACAGTTAAGTTTTACTTTCAGAGATATTGTAGGTGCTAATACTGGATTTAATCTTTCATATGTAATTCCTTTTATGGATCTGTTAGTTATTCAATAAATTCCATAGGTCTGTGTAATATTTTAATTGTATAAAACTCCTTTGTTACTTTATAGCCTGAAATAATGTCTGTCTGCCTTTTAAACCCATTGCAATAACTTTGCTGAAATATTAACACATTAGTAAAACTTTTCTTAAACAAA