Transcript asmbl_45428

Sequence
Transcript Sequence for observation asmbl_45428 of TGE0005472:
CTTTTCTTCTCCCACAATACCTCGTGCTCGTCCTTTCCAGCTTGGTCCCGGCGGTGTGAGTATGGGCGCTTGGTCTGACCTTCAGTAATCTGGCTCCATCCTCTTCCGGGATTGCGTTCACCGAGACAGCGGGGTCTGTCCTGAGCTGGCCCGGGGCTGCGCGTTCCGAGGGATGGAAATTAGCACTGCGTTTAAGGGCTCGTAGCTTGGGAGGGAGAATGGCTCAGAGGAGCCCAGGGCTGCTAGGGTTTCCGGGATGGAGGCACCTGAGGGGAGCGGATTCTTGTGCCGGGAATGGCCGGCTTGGCTTTGCCCCTACCTGGGGAATCGGGGCCCTGGCCGGGCCCTCTGCACCCGGGAGCTTCCCGAGGGCGGCCGCATGAGGGAAGGCCCGGGAGGGAGGACTTGGCTTGTGCTTGTCTCACTCTGCTCTGATCCTCCATGTTGCCTGGATTTAGATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATGCTTAATTTATATGTACAGTTAATATTTTAGTTCACCTACTAGTAATGGCCCCATGAAGAATTTTTAGTGCTAGCTTACGTGGCGCTAAAGCTCAGAGGTAAAGCTGCTTATACATCCAAATCTGAATTCAGCCTGAAAGGAAGGCGCTGCAAGGATTACATTAGTTTTATGCCACTGTAAAGAGGTCATTTCTGAAGCCTTGTTGGTGCTGGCAGTGGACAGCCACTGGCAGTAGGGTTGAGGACCACCTACAGTGTTGCTCTACTCGTTGAGAACACAAGATTTGAAGGGGAGGGGACAGCTCCAGCCTATCTGTTCACTG