Transcript asmbl_45427

Sequence
Transcript Sequence for observation asmbl_45427 of TGE0005472:
GTGAGTATGGGCGCTTGGTCTGACCTTCAGTAATCTGGCTCCATCCTCTTCCGGGATTGCGTTCACCGAGACAGCGGGATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATGCTTAATTTATATGTACAGTTAATATTTTAGTTCACCTACTAGTAATGGCCCCATGAAGAATTTTTAGTGCTAGCTTACGTGGCGCTAAAGCTCAGAGGTAAAGCTGCTTATACATCCAAATCTGAATTCAGCCTGAAAGGAAGGCGCTGCAAGGATTACATTAGTTTTATGCCACTGTAAAGAGGTCATTTCTGAAGCCTTGTTGGTGCTGGCAGTGGACAGCCACTGGCAGTAGGGTTGAGGACCACCTACAGTGTTGCTCTACTCGTTGAGAACACAAGATTTGAAGGGGAGGGGACAGCTCCAGCCTATCTGTTCACTG