Transcript asmbl_44860

Sequence
Transcript Sequence for observation asmbl_44860 of TGE0005450:
CTTTTTCCGTCTCCCGCTGAGGCACCAAGAGGAGCTGTCGCCATGTCCGCCCATCTGCAATGGATGGTTGTACGGAACTGCTCCAGTTTCCTGATAAAGAGGAACAAGCAGACGTACAGCACCGAACCCAATAATCTGAAGGCCCGCAATTCCTTCCGCTACAACGGGCTGATTCACCGCAAGACGGTGGGCGTGGAGCCGGCAGCGGATGGCAAAGGCGTGGTGATCGTCATGAAGCGGAGATCCGGCCAGCGAAAGCCAGCCACCTCCTACGTGCGGACCACCATCAACAAGAATGCCCGGGCCACCCTCAGCAGCATCCGACACATGATCCGCAAAAACAAGTACCGCCCTGATCTGCGCATGGCGGCCATCCGCAGAGCCAGCGCCATCCTGCGCAGCCAGAAGCCCGTGATGGTGAAGAGGAAGCGGGCCCGCCCCACTAAGAGCTCCTGAGACACACACCTCCCCCCTCTGCTCCAAGAAATAAAGGTGTCAGCTGACCCTCAACCA