Transcript asmbl_44851

Sequence
Transcript Sequence for observation asmbl_44851 of TGE0005446:
CGGGGGCGGGGAAGCCGGGCCGGGCTTGATTAGTCAGGAGGCAGAGGCGCGCCGGCGGCGCCCGGAAGTAGCCGAAGCGAGCGGCGGAAGTAGCCGAAGCGTCCGGAGCGGGCGGGCGGCAAGGCGAGGCGAGAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAATGAGAATAAGCAAGAGCGGGACAAGGAGAACCGGCACCGGAAGCGCAGCCACAGTCGCTCTCGCAGCCGGGACCGGAAGCGCCGCAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGCAGCGCCTCCCGGGATAGGCGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTCCGCAAGTACTGGGACGTGCCACCGCCTGGCTTCGAGCACATCACCCCTATGCAGTATAAGGCCATGCAGGCTGCGGGTCAGATTCCAGCCACTGCCCTCCTGCCCACCATGACTCCGGATGGTCTGGCTGTGACCCCGACGCCAGTGCCAGTGGTCGGGAGCCAGATGACCAGACAGGCCCGGCGTCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGACTTCTTCAATGCCCAGATGCGCCTGGGGGGGCTGACTCAGGCCCCTGGCAACCCCGTCCTGGCTGTGCAGATTAACCAGGACAAGAACTTCGCCTTCCTGGAGTTCCGCTCAGTGGACGAGACCACCCAGGCCATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCCCATGACTACCAGCCCCTGCCCGGCATGTCAGAGAATCCCTCTGTCTATGTGCCTGTCCGTTCCTTCCTCCTTCCCTCAGGAGTTGTGTCCACAGTGGTCCCAGACTCCGCCCACAAGCTGTTCATTGGGGGCCTTCCCAACTACCTGAACGATGACCAGGTGAAAGAGCTGCTGACATCATTCGGGCCTCTCAAGGCCTTCAACCTGGTTAAGGACAGCGCGACTGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGTGAGCCCCAGGCCCATGGCGCGGTTGTGTCTGCCATTGCCTTTACCCTGCTCTGTGTCCACCCGGAGGTCTCCCCTTGGAGTTGGGGAGGAGGCAGCCAGCAGTGGCAGGGCCTGCCTGGGGCTTCCCAAGCTCTTGGCCCCTTGCCTTCCCTTCTTTCCCTTCCAGTGCCCAGCTCTGGGATGCTAGGGTTCAGGGGTGGCGTCGGGCTCCTGGTCCCTGACCCACACCTCTTCCCTACATTCCCCCATCGTCCCTCCAACGTAGGCTATTGCGGGGCTGAATGGGATGCAGCTGGGTGACAAGAAACTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCTGTGACCCTGCAAGTGCCCGGCTTGATGAGCTCCCAGGTGCAGATGGGTGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGTGATGAGTGCAGCAAGTATGGGCTGGTCAAGTCCATTGAGATCCCCCGGCCCGTGGATGGTGTCGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGTCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTACCACCGCAGGGACTTCTGGTAGAGGCGGTGGGGGAGGGTGGGGCCGGGCTGGCGTAGGGCTTCTGCCCTGCCACCCCCCCTTTTTCCCCCTCTGAAGACATGGGCAGAGGAGTGACAGCCGAGTGACAGCCGGCAGCAACTGGAATGGCAGC