Transcript asmbl_44348

Sequence
Transcript Sequence for observation asmbl_44348 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCG