Transcript asmbl_44343

Sequence
Transcript Sequence for observation asmbl_44343 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGATGGAGCTGCGGCACGCCTTCTCCCTGTACTGCCTGCACCAGGAGACGCAGCTGGTCCACGCCCACCTGCCCCTCACCTCCCACATCCTCGGGGCCTTCGTCAACTCCCAGATCCAAGGGCACAAGGAGATGAGCAAGGTGTGGGACGACCTGAAGCCCAAGCTGCACTGCCTCTTCGCTGGACCCAACAGCACCTGACCCTGCCAGGGTCCCCAGGGATGGCCTGTCTCCTCACTAGTGCTGCGAGGACCCGGGGCGCAAAACCCACCGGCGCCCTCACTAAAACTTCTTTCCAAACGGTGTGTCCCTGTTTGATTCCCTTCAGAGAGCAGCTGTCCCCCATGTCCCGCGGGCTGCCGCCCTCAAGCAGGAGAGCTGACGTCAGGGCTGGCAGGTCCGGTGCGACGGCGCAGAGCCGAGGACACGGCTGTGGGCTCAGGCTGTGGCCGTCCTGGCCCAGCGCTGTGGCCTGAGGCTTGTGCTGGAAAGCGTCGGCCCCTGGGATGGCTTCCCCTGGGACCTGGAGGCCAGCGTGCGGCAGAGGTTTTCACAGCACACGGTGCCCGGGGGGTGCAGGGGCCCTGTGCTGGAGCAGCCGGAGAGGGAGGCCGAAACCCTGTGGAGGGCAGGAATGTCCCTGCGGTGGCATGTCACCCTGGATGAGGCACAACTGATGAGTGAGAGGGCAGTCCTGGGCGGGGGGTGAGTGTGCGAGGCGGCTGCTGGGGCCAGCAGGGCAG