Transcript asmbl_43676

Sequence
Transcript Sequence for observation asmbl_43676 of TGE0005387:
GGCATGATAGCGAACTTGGTAGGGTTGCACGCGGGTTCAAGTTGTTGTTGGGGTTCTTTTGTGCCAGGGGGCTCTACGAGCTTGGGGCCCCGTTACTACTTTGTCAGTGGGTGCAATGGCGCTTCTCCGGGGTATGTGGGGCGTGCTAAGTGCACTGGGAACGTCCGGAGCTGCTCTCTGCGCAGACTGTGGGAGTCGACTGCGCTCTCCCTTCAGTTTTGCGTATATACCGAGATGGTTTTCATCCGCCTTGATTAGTTATCCAAAGAAGCCTATGACTTCATATGTTCGATTTTCTAAAGAACAGCTACCCATTTTTAAAGCTCAGAACCCAGATGCGAAAAATTCAGAACTAATTAAAAAAATCGCCGAGCTATGGAGGGAACTTCCTGAGTCAGAAAAAAAAGTATATGAAGATGCTTATAAGGCAGACTGGCAGGCATACAAAGAGGAGATAAACAGAATTCAAGAACAGCTAACTCCAAGTCAGATGGTATCTTTGGAAAAAGAAATCATGCAAAAACGTTTAAAAAAGAAAGCAATAATAAAAAAGAGAGAGTTAACAATGCTTGGAAAACCGAAAAGACCTCGCTCAGCTTATAACATTTTTATATCTGAACGCTTCCAGGAAGCTAAGGATGGTACATCACAGTTAAAGCTGAAGACTGTAAATGAAAGCTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATCCAACTTGCTGAAGATGATAAAATTCGTTATTATAATGAAATCAAATCTTGGGAAGAACAAATGGTTGAAGTTGGACGAATTGATCTTCTCCGTCGCAAAATGAAGCCCCAAGCAAAAAGCACTGAGAAGTGTTAAATAGAAGATTGAGTTATGTTCATAGTGGATAGATACAAGAAACCAATTAGGTCTCAATACCTGAAGCCGTTGTTAAATTAGAAAGGATAAAGTTGGTAAACATTTTATACTTAATTCCTTTTTCTTTAGCCCATGGACTTCTGCCAGTTCAATACATTTTGTATGAGTATCTTGCTTTGGAAAACCCAAACAGATAAAAAATTCACTTGAAATTTATTTTGCGTTTAGGAACTACTAAGGGTTAAAATAATCCATGAAATGTATCAATGATCATTTTACCTTTGATAAAGGTGAATCAGACTGTGAAGTTTTTTTATACTTGTTGACTGGGAAGAGTATTCTTGTTTCCTTATATTATGGAGGCAGGGGTTTCATATTCAAAAGTGTCCCAAATTGTAGAGCCATAATGTTCTGTGATATAATTGTGCATTGTTTAAAAGAGCACCAGGAACTCATCTAGGTAAATTCCAATTCCTAGGCATCATTCACATTATATTCAGATTTGGTGGTAATGCAAGGGATTGCTGGTTTCGGTTACAACTTTTTGTATAAAGGATAGAGAGATTTATAAACCTTTTTCTCATTGCCTTTTTTCATAAATTAAAAACTAAGAAATTATGTACCAAATCTATGCATATTTTATATTGCATAGAATACATTTTTTTGTTGTTGTTTCTTAATTACATGTTTAAGATGTAGCAGTTGTTTTACAGCTTCTTTTGGTCTTTTTTTTGTTTGTTTTTTAAAGTAAGGATGTGTAATCTAAATTATTTTTTCTCTCTCGTGTGAGTATATTTATCCAGAAAGTAGAGAACTTGTCTGGTAAGTTTTAAAATGAGAGCTCTAAAAAACAGAAGTCTCCAAAGTCTCTAGACGTGGAACCTGCAATTTTTAAACATTTTATATAACATATAACATATTTTATATAACATATAAAAAGTCAACTTTGACCAATGGGCCAGATCTAGCCCACTGCCTGCTTTTCACGGCCTGTGAGCTAATAATTGTGTTTACAATTTTAAAAGGTTAAAGAGAAAAGGAATATTTCAAGACACGTGAAAATTAACATGAAGGTCAATGTCCATAAATAGTCTTATGGAGTCCAACCATAGTCATTTATTTATTATTTATGGCTGCTTTTGTGCAACAGTGACAGAGTTGAGTAGTTGCTACAAAGACTAGCCTGCAGATGCCAAAATATTTACTGTATGACCCTTTACAGAAAATGTTTGTCAAGCAGTGGTCTCTTAGTATAGCGTAGTATGACAAGTGTTCCAACGTATTAATATGATGGGATAGGTTTTTAAACTATTATAGAGGTTCTTGTTTTAGAATCGTTGTCACCATTGTCTTAAGAGGAAAGAGGTCAGATCACTTACAAGCTAAATAAACTTGTCCCACAGCGTTAGCAAGAAAAATAGTCTTGTTTCAAATTACGTTGCAGTAAAATAAAAAAGATCTATCTAGTATGGAATGAGATTCTCTTAAATTATTTGCTATGGCTTGGTAAAATGAACCTTAAGAGTTTTCCAGTTAGCATATATCACAAAACCCTTTTAGCATTTGTTTACCTCTTGGGAGAATCAGGAATTTTCAAAATCCACATTACTTTTTGAGAAAAATCATGTGTCTTTTGTCATCAGTTCACAGGAATAGGATAATTCAAAATTTATATGTACCTTATATTATGCAAAATATTTAGAAATTCTAGATTCCTTATCTCCAGAAAAATTTTGAAGATTTTTGTCGTAGTAGATAGAAAGTAAATAAACAGTCATGAAAAGGTGACTTGTTAAATACTGAACTTGACAAAGCTAGGGACCGAAGAGAAAAAATATAACTTGGGAGGAAGCTCAAGATTTAAATATGTAAAGTTGGGTGTTTTCAAACAACTTTTACCCTGTGGTTAGGAATACAGGACAAAGTCGGCTATTAGTTAAATAGATACCATGGGGAGGAGGGATTGGGGAAGAAGAGTGTCTATCACAGTCTTTCAAAATTGGGTTTCCAAGAGAGAATTAAGCCCTAATTCTCTGTGGCATCTATAATGGTACTGATTATGTACCATACTTAGGAGAATGGAGAAAATGACTCATCATTTACTGTTTTCTGGGTTTCACACGAGCCCAGGGAGCACATAGGAGTCGGTGTTTGTAACATAGGATGGGTGAGGTAGAGATACGAGTTATGTATACATCTGTAGGACAAATGTAGTATAAAACATCTTTACAATTACCTTTTTCTGAGATATTTTACCATTCAACTACATACACAATTTTATACAGAACACATTTAAGTCCTATCTAACCAATTAGGAAGTTCATTGTATAGTAAGTTCTCAGATGTTTACAACTTAATGTAGGGGGAAAAGTGTGAAACAGTGAAGAGAGCTAGAGCATAACCATTTTGTGATATCAAATTTTGTTTCTAAAGAATATCATTGTTAATTCTTTAAATATTACGACAGTCATTCTACACCTTAGTAAACCAGTATATGTCGAAGATTGGTATGCCATATACCAAATACCATCCAGTTTAACAAGAGGCCATACATTTTCTATTATAAAGGATAAGAACATACCAATAACCAGTGGCCACTCATAATAAAGCCTTACTTTTAGAATTAAGTTGAGTCAACAAAGTAATTGCTGTAGAAGCTAAAGAATGCTAGGGGGAAAGATGCTGAAGAAATAAAACCAGTGTTTTTGCTGTTCTGAGCATATGTTCAGTCATAAAGAAATTTTCATACTTCTGTTCATTGGAGTACCGATATTAGGTTTTTTGAGATAAATGACTTTCTGGTGTTTAAAGATATTGTGTGCAGATTTAACCTACTGTAATCATGTAATGTCGCCGTAGCTTTTGGCTAACTCCTTGTTTGGAAATGCCATTTTTTAACAAGGCATATATTTTATAGTTCTGATGTGTATAT