Transcript asmbl_43647

Sequence
Transcript Sequence for observation asmbl_43647 of TGE0005377:
GTTTGAAATGGCTTCGGTGTTAGCTGTGACCCGATTCAGATCGCTGCTGTAGAAGACAGACAAACGAAGGTTTTTTTCCCCTTTTCATCATGGCTCAGTTTGGAGGACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCTCAGCCAGCTGCATTGGGTGTTCAGCAGCCATCACTCCTTGGAGCATCTCCTACCATTTATACACAGCAAACTGCATTGGCAGCAGCAGGCCTTACCACACAAACCCCAACAAACTATCAGTTAACTCAAACTGCAGCACTGCAGCAACAAGCTGCAGCTGCAGCAGCTGCATTGCAACAGCAATATTCACAACCTCAGCAGGCCTTGTATAGTGTGCAGCAACAGTTACAGCAACCTCAGCAGACCCTTTTAACACAGCCAGCTGTTGCACTGCCTACAAGCCTTAGTCTGTCTACTCCTCAGCCTGCAGCACAGATAACTGTATCATATCCAACACCAAGGTCCAGTCAGCAACAAACCCAACCTCAGAAACAGCGTGTTTTTACAGGCGTGGTTACAAAACTACACGATACATTTGGATTCGTGGATGAAGATGTATTCTTTCAACTTAGTGCCGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGGGTATTAGTTGAAGCTACGTATAATCCTAATATGCCTTTTAAGTGGAATGCACAAAGAATTCAAACACTACCAAATCAGAATCAGTCCCAAACCCAACCTTTACTGAAGACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACAACATTTGGTGTTCAGGCTCAGCCTCAGCCCCAGTCACTGCTACAGGCACAGATTTCAGCAGCTTCTATTACACCACTGTTGCAGACTCAGCCGCAGCCTTTATTACAGCAGCCACAGCAGAAAGCTGGTTTATTGCAGCCTCCTGTCCGTATAGTTTCACAGCCACAACCGGCACGCCGGTTAGATCCACCATCCAGATTTTCAGGAAGGAATGACAGAGGAGATCAAGTGCCTAACAGAAAAGATGACCGAAGTCGTGAAAGGGAGAGAGAAAGACGTAGATCCAGAGAAAGATCTCCTCAGAGAAAACGTTCCCGGGAGAGATCTCCTCGAAGAGAGAGAGAACGATCACCTCGGAGAGTTCGCCGTGTTGTTCCACGTTACACAGTTCAGTTTTCAAAGTTTTCTTTAGATTGTCCTAGTTGTGACATGATGGAACTAAGGCGCCGTTATCAGAATTTATATATACCTAGTGACTTTTTTGATGCTCAGTTTACATGGGTGGATGCTTTCCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTGCAATTTCTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAACATGGCCATTCTTGATCCACCAGATGCTGACCACTTATACAGCGCAAAGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATTTGTATCATAAGTCATGTGCTCTTGCTGAAGACCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGACTTGTTAAGTTTTTAGTGGGCATGAAAGGCAAGGATGAAGCCATGGCCATTGGAGGCCACTGGTCTCCTTCGTTGGATGGACCAGACCCAGAAAAAGACCCCTCTGTGTTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTATGCACACAATGGTACCGTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGCTGATGGAGAACAGGATGAAGAAGAGAAGGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTTGATCCAAAGACAATGAAGGTAAATGATCTCCGAAAGGAATTAGAAAGTCGAGCCCTTAGTTCCAAAGGGTTAAAATCCCAGTTAATAGCCCGCCTGACAAAACAACTTAAAGTAGAAGAGCAAAAAGAAGAACAAAAGGAATTAGAGAAATCTGAAAAAGAAGATGAAGAGGAGGATGATAGGAAATCTGAAGATGATAAAGAGGAAGAAGAAAGAAAACGTCAAGAAGAAATGGAACGCCAGCGTCGAGAAAGAAGATATATTTTGCCTGACGAACCAGCCATTATTGTACATCCAAATTGGGCTGCAAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACTTTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTGTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGTCAGAATATACAAATCATTATTATCTCTTCCTGAGAAAGAGGACAAAAAGGAAAAGGAAAAGAAAAGTAAAAAAGATGAGAGAAAAGATAAAAAAGAAGAAAGAGATGATGAAACTGATGAGCCAAAACCCAAACGGAGAAAATCAGGCGATGATAAAGATAAAAAAGAAGATAGAGATGAAAGGAAGAAAGATGATAAAAGAAAAGATGATTCTAAAGATGATGATGAAACTGAAGAAGATAATAATCAGGATGAGTATGATCCAATGGAAGCTGAAGAAGCTGAGGATGAAGAAGATGATCGAGATGAGGAAGAAATAAACAAACGAGATGACAAAAGAGACATCAACAGGTACTGCAAGGAGAGGCCCTCTAAAGATAAGGAAAAAGAAAAGACTCAGATGATCACAATTAACAGAGATCTGTTAATGGCATTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAGGTAAAGAAGCTTCTTAATAAAGTAGTACTTCGTGAATCTTGCTTTTACCGTAAACTAACAGACACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAAGCATTACATGAAGATATGCTAGGAAACAGGTTATTACTTCCAACACCAACAGTGAAACAGGAATCCAAGGATGTGGAAGAAAATGTTGGCCTGATTGTGTATAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAAATTGGAAAAGAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAAGCTACAGTTACTAGAAGAAAAAACAGATGAAGATGAAAAGACCATATTAAATTTGGAAAATTCCAACAAAAGCCTCTCTGGTGAACTCAGAGAAGTTAAAAAGGACCTTAGTCAGTTACAAGACAACTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACCAACTGAATAAGACAATCAGAAACTTATCCACAGTAATGGATGAAATCCACACTGTTCTCAAGAAGGATAATGTGAAGAGTGACAATAAAGATCAGAAATCCAAGGAGAATGGCGCAAGTGTATAATACACGTAGTGATGAGGAATGGTGTTAAATAATGTAATATAAAAAAATCATGATACAAGAATGTTTGAAAGTGATGCATGTTTGATTTTAGTAGTATAAATATCTGTTAGTTCAAATGATGTATAAAGTTTTATGAATGTGAGAGTCTCTGCTTTTGAAAATTGCTTGTAATTCCTGGCATTGAAATTATAAAACACTCCTTGAGTGAAATAATTTTGCATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAGTTCATCAGTTTAATTGACAATAGTATTTAATTACCAAATGTCTTTTATTAAAA