Transcript asmbl_10819

Sequence
Transcript Sequence for observation asmbl_10819 of TGE0000035:
GCCTATTAGTGTCATCCTCACCGTCACGGCCGGCGCCTCCTCCTGGATTCATTCACTCGCTCTTTTCATTCACGAAGGTAGTGAGGCCTAGTGGAAAGCCATGGAGAGCGCTCTCCCCGCCGCCGGCTTCCTGTACTGGGTCGGCGCGGGCACCGTGGCCTACCTAGCCCTGCGTATTTCGTACTCGCTCTTCACGGCCCTCCGGGTCTGGGGAGTGGGGAATGAGGCGGGGGTCGGCCCGGGGCTCGGAGAATGGGCAGTTGTCACAGGTAGTACTGATGGAATTGGAAAATCATATGCAGAAGAGTTAGCAAAGCATGGAATGAAGGTTGTCCTTATCAGCAGATCAAAGGATAAACTTGACCAGGTTTCCAGTGAAATAAAAGAAAAATTCAAAGTGGAGACAAGAACCATTGCTGTTGACTTTGCATCAGAAGATATTTATGATAAAATTAAAACAGGCTTGGCTGGTCTTGAAATCGGCATCTTAGTGAACAACGTGGGAATGTCGTATGAGTATCCTGAATACTTTTTGGATGTTCCTGACTTGGACAATGTGATCAAGAAAATGATAAATATTAATATTCTTTCTGTTTGTAAGATGACACAATTGGTACTGCCTGGCATGGTGGAAAGATCCAAAGGGGCTATTCTGAACATTTCATCTGGCAGTGGCATGCTCCCTGTCCCACTCTTGACCATCTATTCTGCAACCAAGACTTTTGTAGATTTCTTCTCTCAGTGCCTCCATGAGGAGTATAGGAGCAAGGGCGTCTTTGTGCAGAGTGTCCTGCCATACTTCGTAGCTACAAAACTGGCTAAAATCCGGAAGCCAACTTTGGATAAGCCCTCTCCGGAGACGTTTGTGAAGTCTGCAATTAAAACAGTCGGCCTGCAATCCCGAACCAATGGATACCTGATCCATGCTCTTATGGGCTCGATAATCTCAAACCTGCCTTCTTGGATTTATTTGAAAATAGTCATGAATATGAACAAGTCTACACGGGCTCACTATCTGAAGAAAACCAAGAAGAACTAAGCATTGATAACTGCATTGTAACTTGGCCAGATGCTCCAGCATATGCACGTTCACTGCAAAGCACCCTACTGGTTTTGAAAATCTGACCTTGTCATTTCAATAGTTATTAACATGACTAAATATTATCTTAATTAAGAGGAAAATAGAAGTTGCTTTTAGGGGTTTCTGACATATATTCTGGATACTATCCGAGGTAATTTTGAAGTTTAATATAAATGCTCATATCAAATGAATATAGAACTAATATTGTCGGGAACACCTAATAGAAAGGAATACTATTATAGCAAATCACAGAATGATAGACTCAAGCATAAAACTTGGCAGTTTTATCTGCTTCAAAATGCCATTGATCATTATTCCTGTATTTTCTCTGAAACTGATTATAAAAACCAATGTCCAGCTACTCTTTTGTTTTTGACACTTGAAGAAATGGAGATCGATTTGATTTGTTTATAAGCAGACACACTGCAATTTACAAAGATCTCTTTACGGTTTTATAAAATTATCTTC