Transcript asmbl_43561

Sequence
Transcript Sequence for observation asmbl_43561 of TGE0003333:
ATGATTGGCCGGCGAAGAGTGGCTCTCTTTTCCTCCTTGGCTGCTTGAAGGCCTTCTGCCATCATGAATGACACAGTAACTATCCGGACCAGGAAGTTCATGACCAATAGGCTACTTCAACGGAAACAAATGGTCATCGATGTTCTTCATCCTGGAAAGGCAACAGTACCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCAGATGTCATTTTTGTATTTGGATTCCGAACCCATTTTGGTGGTGGCAAGACAACCGGCTTTGGCATGATTTATGATTCCTTGGACTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCAAGAAAACAGCGAAAGGAACGCAAGAACAGGATGAAGAAAGTTAGAGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGACAACAGAAGGAGTAAAGATTCGTCAGTGACTCTGGTGATCAGATTCTTCATGAGAGGATTAATAAACTAATAACTTTTATGTG