Transcript asmbl_42903

Sequence
Transcript Sequence for observation asmbl_42903 of TGE0005318:
CCGAAAGACGGAGCCCGAGCCTCGGGGGCTCCTTAGCAACGGGCCGGGGCGGGAGTTCCATGGAGACTGGGGAGCGCGCCCGCCTCATCATCATCCTTGCCCTCCAGCTTATCCTTCGCGTCCGACGCAACCGGCAGCACTGCTGCCGCCGCGTCCTCTGCCACCGCCACCTTTTCCCACGGATGTGATCTTCGTGGTGGGAAGCTAAGTTTTTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTCTGATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGTCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGACGTTGGAAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCTCGCAGTCTCCAAAAACTAGGTTTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTTTAGCAGTATGTAACATGCCATTTGAAATCCGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTATGAACCTGAACTTCATCCTGCTGTGTGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTGTAATTCATCACTTAATTGGTTAGAATCCCTAACTGAGCACCTTTTAAAACCTGCTGCACATTGGACTCAAAACAGAAGGAAAACTGGACCAACAGCAATCGAGGAAATAGACTCTTATTCTTTCATGGCTGCAGTGTAAGCTCCAGGCCCTTTGGGTTTTATTTCAAACCTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACGTTGCTGCTTTTACAAAAGGACATTCTATTTATTTTTGCAGTAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAAATTGTTTAGTTGTTATTTTTTTCCAGTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTG