Transcript asmbl_42612

Sequence
Transcript Sequence for observation asmbl_42612 of TGE0005296:
GCCGGAGTGAGAGAGTTTGGCGGCAGTAGCGGGGCGTGTGAGGTGTCGGTGGGAGGCTCGGAAACAAGCTCACTTCTCCCTGTTGGAAATCCAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCAGAGGTCTTTCTCGTGCTGCTTCTCTGCATTCCCTTCATTTCACCCAAAAGATGGCAGAAGATTTTCAAGTCCCGCCTGGTGGAGTTCGTAGTGACCCATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGCTGGTCATTGATGCTCTGCGTGAGATTCGGAAGTATGATGACGTGACAGAGAAGGTGAATCTCCAGAACAACCCTGGGGCCCTGGAACACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCCGGCTTTTCTCTGCTGCTGTCCTTCCTGCTTAGACGACTGGTGACTCTCATCTCCCAGCAGGCCACTCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCAGAGAGCGCTAGTGAGGCGGCCAAGAAGTACATGGAAGAGAATGACCAGCTGAAGAAGGAAGCTGCTGTCGGTGGCGTTGAGTTGAGTGCCAGGGAGGTGACTTTGGAGTTAGAGACCAGTAACCTGAAGGCCGATCTGAAGAAGCTGAAGGATGAGCTGGCTATAAACAAGCAAAAACTAGAGAAAGCTGAAAACGAGGCTCTGGCCATGCGGAAGCAGTCCGAGGGCCTGACCAAGGAGTACGACCGCCTGTTGGAGGAGCACACGAAGCTGCAGGTGGCAGTAGATGGTCCCACGGACAAGAAGGAGGAGTGAGGGCCCCTCCCGCCCGTGGCCTGGCCTGAGCTCGAGCTCGCCACTTCCCGAGAGCCAGGCCTCTCTGGGCACTTGCACTTCCCACCCCTCACACTGCCTACAGTTCATTGTTCTCCCAGCGCCCCCCAGAGGACCGGGCTCCCACCTACTCAGGATGCATTTGTCACCAGCTTGGCTATCCAGGAGCATGGTGGGCCCCTGGAACCCTCGTGATGGGTCTTGCTTCTTGCTGGGCGGAGCCCCTTTTTTTGTTGCACGTTGATGTTTGGGCTCCAAGTCCCCTTTTCTCTGCTCCTGCAGGAGGGTGGGCGAAGCAGGCAGAGTTTCTGTTGGGGGCAATAAAGGTTATTATGATGTG