Transcript asmbl_425

Sequence
Transcript Sequence for observation asmbl_425 of TGE0024674:
GGAGACTACTCACCGCGCGGTCAGCTCGGCAGCGGGGCCAGGCGGTGAGGCGGCACGTGGCGCTCGCGAGCCATGTCGTGGCTCTTCGGCATCAAAGGCTCCAAAGGCGAAGGCACGGGACCGCCGCTTTCCCTGCCGCCCGTGCAGCCTGGGGCCGAGGGCGGCGGGGATCGCGGCGCGGGAGACCGGCCGGGGCCCAAGGACAAATGGAGCAACTTCGACCCGACGGGCCTGGAGCGCGCAGCCAAGGCGGCGCGCGAGCTGGAGCACTCGCGACACGCCAAGGAGGCGCTGAGCCTGGCGCAGATGCAGGAGCAGACGCTGCAGCTGGAGCAGCAGTCCAAGCTCAAAGAGTACGAGGCCGCCGTGGAGCAGCTGAAGAGCGAGCAGATCCGCGTGCAGGCTGAGGAGCGGCGGAAGACCCTGAGCGAGGAGACGCGGCAGCACCAGGCCAGGGCCCAGTACCAGGACAAGCTGGCCCGGCAGCGCTACGAGGACCAGCTGAAGCAGCAGCAACTTCTCAACGAGGAGAATTTACGGAAGCAGGAGGAGTCTGTGCAGAAGCAGGAGGCCATGAGGCGAGCCACCGTGGAGCGAGAGATGGAGCTGCGGCACAAGAACGAGATGCTGCGGGTGGAGGCCGAGGCGCGTGCCCGGGCCAAGGCCGAGCGCGAGAATGCAGACATCATCCGCGAGCAGATCCGCCTGAAGGCTGCTGAGCACCGCCAGACCATCCTGGAGTCCATCCGGACGGCTGGCACCTTGTTTGGTGAAGGATTCCGTGCCTTTGTGACAGACTGGGACAAAGTGACCGCCACGGTAGCCGGGCTGACGCTGCTGGCTGTCGGGGTCTATTCTGCGAAGAACGCCACATCGGTCGCAGGGCGGTACATCGAGGCCCGGCTGGGGAGGCCGTCCCTGGTGAGGGAGACCTCGCGGATCTCGGTGCTGGAGGCTCTGTGGCACCCCCTGCAGGTCAGCAGGCGGCTGCTCAGCAAGCCTCAGGACGCCCTGGAGGGTGTTGTCCTCAGTCCCAGCCTGGAGGCGCGTGTGCGGGACATCGCCATTGCGACAAGGAACACCAAGAAGAACCGCAGCCTGTACAGGAACATCCTCATGTACGGGCCGCCCGGGACGGGCAAGACGCTGTTTGCCAAGGAGAAGATAAGCGAGGACCTCAGGGCCACCCTGAACGCGTTCCTGCACCGGACGGGCCAGCACAGCAGCAAGTTCATGCTGGTCCTGGCCAGCAACCAGCCCGAGCAGTTCGACTGGGCCATCAACGACCGCATAGACGAGATGGTCAGCTTCGACCTGCCACGGCTGGAGGAGCGGGAGCGCCTGGTGAGAATGTATTTCGACAAGTACGTTCTGAAACCAGCCACAGAAGGGAAGCAGCGCTTGAAGCTGGCTCAGTTTGACTACGGGACGAAGTGCTCGGAGGTCGCGCAGCTGACGGAGGGCATGTCGGGCCGGGAGATATCCCAGCTGGCCGTGGCGTGGCAGGCCATGGCCTATGCCTCCGAGGACGGTGTCCTCACCGAGGCCATGATGGACGCCCGAGTCCAGGACGCCATCCGGCAGCACCAGCAGAAGATGCAGTGGCTGAAGGCCGAGGGACCCGGGCCCGGCAGTGGCCAGCCCCTCCTCCTGAGTGCACGGACCAAGTGAGCTGGGCCTCGACAGCTGGGGACCCTGGGGCACACCCGCTTGGTGGCTTCGCCAGAGGAAACACCAAGGCGCCCGCGTCTCCTGGCGGCCAGCAGGGGGCTCTGCAGCCGCCCACCTCCCGGCAGTTTTTAATATTCCTCCGCTCAGGGCCAGGGCAGCATTAAAGGCCTCTACTTAGGACCAGCTGCGGCTGTGGCGTCTTTGTGGGGGGGAATCTGCCCCTCCAGGCTGTGGTTTTGGCTGGGGAGGGTCAGGCTGGGGCTACCCCCAGGACACTCCTAGGGGACGTGTCTCCAAGCCAGGCCCAGAGCGGGAAGAAGGCACAGCCCCCCGGTCCAGGGGTAGCTGAGAGCTGGCTGCTGCAGTGGGGGCGTCTAGCCAGGGGAAGGCCTGGCACAGTCGGGGATCCGTGAGGGGTGAGCAGAGCAGGCCCGTGCTGCCCGTCAGAGCTGCCCGCCTCTGCACTGGGGAAGAGGAG