Transcript asmbl_42264

Sequence
Transcript Sequence for observation asmbl_42264 of TGE0005287:
CCTGTCCCCCCCTTTCCTGTGGGCCATGGGGCTCGTCCTCTCCTGCTGTCCCTGCCTGGCCCGTGTTGGGCTCCTCCTCCTGCTACTCCGACCTCTGACCCTGCCCTCGGGTATCTTTCGTGGGACCGGCGCGGTGCCTGCCTTCCTCTCTCCTCGCCGTTCTCCATCCCGTGGACGGAATTTTGCATCTCCCTGCTCTGTCTTCCTTTTTCCCGTGGACGTTTTCCCTGGACGTGTATTTGCATCTACTCCTCCTATGTTCCTCTTCCCTTTCTGACCCCAAAACCGTACACATCGTCCTCCCCTCCGGCCGTCTGTGCCCCCGTCTTCCTGGCCCTGGGCTGGCCCTTCTCCTCCTGTCTCTGGCCCTCCTTGTGTCTTGGTGCCACTGCCCCCACAGAAGAAGACAGGCATGATGGACACGGATGATTTCCGCGCCTGCCTTATCTCCATGGGTTACAACATGGGAGAGGCAGAATTTGCCCGCATCATGAGCATTGTGGACCCCAATCGCCTGGGGGTAGTGACATTCCAGGCCTTCATCGACTTTATGTCCCGTGAAACGGCCGACACGGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCAGGGGACAAGAACTACATCACGGTGGACGAGCTGCGCCGGGAGCTGCCGCCGGACCAGGCCGAGTACTGCATCGCGCGAATGGCCCCCTACACCGGCCCTGACGCCGTGCCCGGTGCTCTGGACTACATGTCCTTCTCCACAGCGCTCTACGGCGAGAGTGACCTCTAACCCGCCCCCACTCGTCCAGCGCCCTCGCCCCTGCCCGCGTGAGCCCCGCCCTGCACCTCCGCTGTACCCCCTCTCCTGCCCGGGTTTGGTTTCCACGCCCAGCCTCCAACCGGCCAGCTGGGACCCGCCGCGGCGCTGATCCTCCCTGCCCGCCAAGTGACAGTTTACAAAATTATTTTCTGCAAAAAAGAAAAAAAATTATGTTAAAAAAAGTAAAAAAAACCAAAAAACCGCATATTTTATTATAGAAAAAGTATTTTTTTCTCCACCAGACTTAAATGGAAAAGAGGAAAAATTAACTATTTGCACCGAAATGTTTCGTTTTGTTGTGACATAGGAAAATAACTAAGCACAATGTTATATTTCATCCTTTTTATCGACTTTTTTTTCTATCTGTCCCATCTGCTGTATTCATTTCTCCAATCTCATGTCCGCCTTGATGTGGGAGTGGGGGGTGGGAGGTAGGGGATGATCTTGTCAAAAGGCACATTGGTGCATGTGTGTTTGCTAGCTCACTTGTCCATGAAAATATTTTATGATATTAAAGAAAATCTTTTGAAATGGATGTTTTTGCAAGGAAGAGGATTTATGTGGCTTGTCTCATTTTTAAGTTTAGAGGTGTGATTAGCCTCTTCATCCGTGCACTTTTTTTTAAACTATAACATTACCTATTAAAAATGGTCAGGACAAAATTGGAGTATGGGCAACTTTGATATTGCTTGGCACAGACCGTATTA