Transcript asmbl_42211

Sequence
Transcript Sequence for observation asmbl_42211 of TGE0005280:
CGTCAGTTGTGGACAGACGTAGGCGAGTTGTGTCCTGGTCTGCGGGGAGGTAGAGGACTCCGTCGCAGACTACGGACCTCTCTTGGGTCTCAGCTGCCAAAGATCCTGTCCGGTAGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGT