Transcript asmbl_8621

Sequence
Transcript Sequence for observation asmbl_8621 of TGE0000049:
ATTGACTTAAACCTGAAAGGACCCAAAGTGAAGGGTGATGTGGATGTTTCACTACCTAAGGTGGAAAGTGATCTGAAAGGGCCAGAGGTAGACATTGAAGGTCCTGAAGGGAAGCTCAAAGGTCCCAAGTTTAAGATGCCTGATGTACATTTCAAAAGCCCACAAATCTCCATGAGTGACATTGATTTGAATTTGAAAGGACCTAAGATAAAAGGAGATATGGACATTTCCGTTCCTAAACTGGAGGGAGATCTGAAAGGTCCCAAAGTGGATGTCAAAGGCCCTAAAGTGGGCATTGACACTCCTGATATTGACATTCATGGTCCAGAAGGGAAACTGAAGGGCCCCAAATTTAAAATGCCTGAC