Transcript asmbl_40194

Sequence
Transcript Sequence for observation asmbl_40194 of TGE0005158:
CGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCCGCGCCCTTGGGCTGGGACTCCACAGGCTGGCGGGAGGCTGGTCGCGTCACCCACGCCCCCGCCGCGCCCCGTTTCTATAAATTGCGAGCGCAGCCTCCCCCAGCGCTCTCTGCTCCTCCCGTTCTACAGACAGCCGCGTCCTCCTGCGCAGTGCCAGCCGCGACCCTGAGACACGATGGTGAAGGTTGGAGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGCAAAGTGGATATTGTCGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGATTCCACCCATGGCAAGTTCAAAGGCACAGTCAAGGCTGAGAATGGGAAGCTTGTCATCAATGGAAAGCCCATCACCATCTTCCAGGAGCGAGATCCCACCAACATCAAATGGGGTGATGCTGGTGCTGAATATGTTGTGGAGTCCACTGGTGTCTTCACTACCTTGGAGAAGGCTGGGGCTCACTTGAAGGGTGGAGCGAAGCGGGTCATCATTTCTGCTCCTTCTGCGGATGCCCCCATGTTTGTGATGGGTGTGAACCATGAGAAGTATGACAACTCCCTCAAGATTGTCAGTAATGCCTCCTGCACCACCAACTGCTTGGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGACTCATGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCCAA