Transcript asmbl_39157

Sequence
Transcript Sequence for observation asmbl_39157 of TGE0005118:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACTATGAGAGTAAGTTGCAGGCCTTGCAGAAGCAGGTGGAGACTCGGTCCCTTGCTGCAGAAACAACCGAAGAGGAAGAGGAGGAGGAAGAA