Transcript asmbl_39140

Sequence
Transcript Sequence for observation asmbl_39140 of TGE0005114:
CGGCCCTAGCGCCATTTTGTGGGAGCGAAGCGGTAGCTGGGCTGCTCCTGGATCCCTGGCTGCTCCGCGTCTCCGTGTCGGGCTTCCTAGCAGCAGCCTAGCGGAAAAATAAAAGATGTCTGAATATATTCGGGTAACCGAAGACGAGAATGATGAACCCATCGAAATACCATCAGAAGACGATGGGACAGTACTGCTTTCCACAGTTACAGCTCAGTTTCCAGGGGCCTGTGGGCTGCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTGGAAGGAATTCTGCATGCCCCGGATGCTGGCTGGGGAAATCTGGTATATGTTGTCAACTATCCCAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTTCAGAAAACATCTGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACTGAACAAGATCTAAAAGAATATTTTAGTACCTTTGGAGAAGTTCTTATGGTTCAGGTCAAGAAAGATATTAAAACTGGTCATTCAAAAGGCTTTGGCTTTGTTCGATTTACGGAATATGAAACCCAGGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGTAAACTTCCTAATTCTAAGCAAAGCCCAGATGAACCTTTGAGAAGCAGAAAGGTGTTCGTTGGGCGTTGTACGGAGGACATGACTGCTGATGAGTTGCAGCAGTTCTTCTGCCAGTATGGAGAAGTGGTAGATGTCTTCATTCCCAAACCGTTCAGGGCTTTTGCCTTTGTTACATTTGCAGATGATCAGGTTGCCCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTACATATATCCAATGCTGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTCGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAACAGTAGGGGGGGCGGAGCTGGCTTGGGAAACAATCAAGGTAGTAATATGGGTGGGGGGATGAACTTTGGTGCTTTTAGCATTAATCCAGCAATGATGGCTGCAGCCCAGGCAGCACTGCAGAGCAGCTGGGGTATGATGGGCATGCTAGCCAGTCAGCAGAATCAGTCAGGCCCATCAGGTAATAACCAAAGCCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTTGGTTCTGGAAATAATTCTTATAGTGGTTCTAATTCAGGTGCAGCAATTGGTTGGGGATCAGCATCAAATGCAGGGTCAGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAACCTTCTAGCTGGGGAATGTAGACAGTGGGCGATGGTTGTATAGACTGGTGGGAATTCAAATTTTTCTAAACTCATGGTAAGTATATTGTAAAATACATATGTACTAAGAATTTTCAAAATTGGTTTGTTCAGTGTGGAGTATATTCAGCAGTATTTTTGACATTTTTCTTTAGAAAAAGAAGAAGAGCTAAAGGAATTTTATAAGTTTTGTTACATAAAGGGTTGAAATATTGAGTGTTTGAAAGTGAACTGCTGTTTGCCTGATTGGTAAACCAACACACTACAATTGATATCAAAAGGTTTCTCCTGTAATATTTTATCCCTGGACTTGTCAAGTGAATTCTTTGCATGTTCAAAATGGAAACCATTGATTAGAACTACATTGTTTTCTCCTTGTTTTAATTTGAACCCCACCGTATGGATTTTTTTCCTTAGGAAAACTCTCCGTTTTGGAGATCATGGTGTCACAGTGTTTGGTTCTTTTGTTTGTTTTTTAACACTTGTCTCCCTTCATATACAAAAGTACAATATGAAGCCTTCATTTAATCTCTGCAGTTCATCTCATTTCAAATGTTTATGGAAGAAGCACTTCATTGAAAGGAGTGCTGTAAATGCTCTGCCATAGGAATCCTTCCGCCTACATGCTTTCTCATTCAGGAATTTGTCATCACGCTGCACAGGCTGCGTCTTTGACGGTGGGTGTCCCATTTTTATCCGCTACTCTTTATTTCATGGAGTCGTATCAACGCTATGAACGCAAGGCTGTGATATGGAACCAGAAGGCTGTTTGAACTTTTGAAACCTTGTGTGGGATTGATGGTGGTGCCGAGGCATGAAAGGCGAGTATGAGCGAGAAAAGGAGAGCGCGTGCAGAGACTTGGTGGTGCATAATGGATATTTTTTAACTTGGCGCGATGTGTCTCTCAATCCTGTGGCTTTGGTGAGAGAGTGTGCAGAGAGCAATGATAGCAAATAATGTACGAATGTTTTTTGCATTCAAAGGACATCCACCTCTGTTGGAAGACTTTAAGTGAGTTTTGTTCTTAGATAACCCACGTTAGTTGAATGTGTTAAGTGAAACGATACTTGTATTTCCCCTACCCCTTTGTCAACTGCTGTGAATGCTGTATGGTGTGTGTTCTCTTCTGTTACTGACCTGTAAGTGTGGTAATGTGAACTGAAGCTGATGGGTTGAGAACATGGACTGAGCTTGTGGTGTGCTTTGCAGGAGTACTTGGAAGCAGAGTTCACCAGTGAGCTGGGGGTGTCTCAAAGAAGGGTGGAAGTTCTAATGTCTGTTAGCTACCCATAAGAATGCTGTTTGCTGCAGTTCTGTGTCCTGTGCTTGGATGCTTTTTATAAGAGTTGTCAATGTTGGAAATTCTTAAATAAAACTGATTTAAATAATATGTGTCTTTGTTTTGCAGCCCTGAATGCAAAGAATTCATAGCAGTTAATTCCCCTTTTTGACCCTTTTGAGATGGAACTTTCATAAAGTTTCTTGGCAATAGTTTATTTTGCTTCAAATAAACTTATTTGAAAAGTTGTCTCAAGTCAAATGGATTCATCACCTGTCATGCATTGACACCTGATACCCAGACTTAATTGCTATCTGTTCTTGCATTGTCCAAAGTGA