Transcript asmbl_3914

Sequence
Transcript Sequence for observation asmbl_3914 of TGE0012472:
TGACACGTGAGTCCAGTCTCTTTATAGGTTCCGGTTAGCATACCGGTGTCCCCCTGCCATCCCTCTCTCTCTGCAGGCCAAGAGGTGCACGGTGATCGGAGGCTCTGGGTTTCTGGGACAGCACATGGTGGAACAGTTGCTGGCAAGAGGCTATGCTGTCAATGTATTTGATATGCGACAGGGGTTCGACAATCCCCAGGTGAAGTTCTTTATGGGCGACCTCTGCAACCAACAGGACTTGTACCCAGCTGTGAAAGGTGTGAGTACAGTTTTCCACTGTGCATCACCCTCCCCATCAAGTAACAACAAGGAACTCTTTTACACAGTCAATTACATTGGCACCAAGAATGTCATCGAGACTTGCAAACAGGCTGGGGTTCAGAAACTCATTTTAACCAGCAGTGCTAGTGTTATCTTCGAAGGTGTCGACATCAAGAATGGCACAGAAGACCTTCCATATGCCATGAAACCCATTGACTACTACACAGAAACAAAGATCTTACAGGAGAGAGAGGTCCTGGTCGCGAACAATCCCGAGAAGAATTTTTTCACCACAGCTATCCGCCCCCATGGCATTTTCGGCCCAAGGGACCCCCAGCTGGTCCCCACCCTCATTGAGGCAGCCAAAAAAGGCATGATGAAGTTTATCATTGGAAACGGAGAGAACTTGGTGGACTTTACCTTCGTGGACAACGTGGTCCACGGACACATTCTGGCCGCAGAGCACCTTTCACAAGACACGGCCTTGGCTGGCAAGGCGTTCCACATCACCAATGACGAGCCCATCCCTTTCTGGACATTCCTGTCGCGCATCCTGACAGGCCTCAATTACGAGGCCCCTAAGTACTATATACCCTACTGGGTGGCCTACTACCTGGCCCTCCTGCTGTCCCTCCTGGTGACAGTGCTCAGCCCTGTTGTACAGCTGAAGCCCACTTTTACACCCATGCGTGTCGCACTGGCTGGCACATCGCACTATTACAGCTGCGAGAAAGCCAAAAAAGCCATGGGCTACCAGCCACTGGTCACTATGGACGACGCCGTGGAGAGAACTGTGCAGAGCTTCCACCACCTGCGCAGAGTCGAGTGAGGTCCCCGAGATGGGGCCCCCTCGCCGTGCTCCCCCATGGATAGCTCTCTCTGTGGGGGACCAATAAACTAACCTCCTTTAAGTG