Transcript asmbl_38872

Sequence
Transcript Sequence for observation asmbl_38872 of TGE0005083:
AGCTGAGGAAGTAGGTGGGCCGGGTCGCGCCGCCTCCGGTGCCGGCCGTCCCTCCGTCTACCTTTCCGCCGCGGGCTCACCATGCCGCAGTATCAGACCTGGGAGGAGTTCAGTCGCGCGGCCGAGAAGCTCTACCTCGCCGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAGTTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAGAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAATCCCGCAGTGTTGCCATGGAAACAGACTGAATGGTTTGAAATGAAGACTGTTTGACATGTTCTTAGGAGTAAACATCTTTTGAATTTGAGGAAGTGTTGGGACAGAAAATACTTTATGTAACTAAGTGGGCTATTCAGAAGCCAAAAGATCATTTTTTTGTACATTGTTTTTTTAATGTTTCCTTTAGAGAGCTGGGAATAGAAATGATTTCGATTAGAAAGCCTTTATTTATTTTTGGAAATTGAACAAGAACTGCATCTATCTTGGGAACTTTTTGCGGATTATTTAATGCTGGGCAAAATATATAGCTATTTCTTTTGGTAAATTCGTATTGGTAATTTGAAAATGAGATGTCAAGAAAAGTCTATTCTTTAAATTTAGTTTATCCATCTTTAAAAGAAAATTAAACTCAACCATTTTACCGAATCGATAGACTTCTTTTGGAGCATAAAATTTGTATTGTTGATGACTAACAAATATAAACTATGGTAACTAGAATTAACTGCATAGCAGTATACCTAACAATATACAGTAGTATAGTCTAGATTGTATCTGAAAATAATTATGAAAACAAGTATGCTTTACCTTAAACTTTCAAAACTTAATCTATATTTTTGAGTATAAGAGTTTTATAATATTAATAGTTTGTTGAGCAGACTTACTTTGAATCTAGTTTTCAGTGCTCAAAACAACTGCAGTTCCTTTAAATGCATGAACAGAATATTCAGCGATGGACTGAAACCAGCATGTTACAGAAGTATTTGCCACACATTTCCCATCTGTAGTTTCTAAGAAGGGCTAAGGATTATGTAAATTGTTAAATTTTTGCAAAGCTCTTTGACACCCCTCCCCATTTCTCTACTTATCCAGCGGGTTAGCTTGACTGTCACACTTGTTATGTTTTCCATTAAACCAGAAGTATGATATTTAGTATTATCTATTTGTAACCTTAATTTTACCACCTAAATGTAATGTTCACTTGTCGATTCCTACATTAAAATATTTTTGGTATGGAACTTT